Báo cáo " Community based coastal resources management behind changes in surface water environment and land policy: A case study in the Tam Giang Lagoon, Central Vietnam " ppt

Báo cáo " Community based coastal resources management behind changes in surface water environment and land policy: A case study in the Tam Giang Lagoon, Central Vietnam " ppt

Báo cáo " Community based coastal resources management behind changes in surface water environment and land policy: A case study in the Tam Giang Lagoon, Central Vietnam " ppt

... sustainable coastal fisheries management in Southeast Asia. Ocean & Coastal Management, Vol 27, No 3, pp. 143. [7] Ton That Phap, 2002. “Co -management in the planning of a waterway system ... based coastal resources management activities in the Tam Giang Lagoon, Central Vietnam. The results show that the lagoon’s surface water has been pol...

Ngày tải lên: 14/03/2014, 15:20

11 530 0
Báo cáo khoa học: "SVM Model Tampering and Anchored Learning: A Case Study in Hebrew NP Chunking" pdf

Báo cáo khoa học: "SVM Model Tampering and Anchored Learning: A Case Study in Hebrew NP Chunking" pdf

... anchored data (as the anchored data is guaranteed to be linearly separable, we can set avery high value to the C parameter, preventing any mis- classification), and then investigating either the ... Anchored Learning is to add a unique feature a i (an anchor) to each training sample (we add as many new features to the model as there are training samples). These new features make...

Ngày tải lên: 23/03/2014, 18:20

8 507 0
Tài liệu Báo cáo khoa học: "Man* vs. Machine: A Case Study in Base Noun Phrase Learning" pdf

Tài liệu Báo cáo khoa học: "Man* vs. Machine: A Case Study in Base Noun Phrase Learning" pdf

... tags, rather than looking at each individual word and deciding whether it is part of a phrase or not. The rule actions we allow are: 2 Add Add a base NP (bracket a se- quence of words as ... and all words within a window of 3 to either side of it. Applying a rule to a word changes the chunk structure tag of a word and in effect alters the boundaries of...

Ngày tải lên: 20/02/2014, 19:20

8 498 0
Tài liệu Báo cáo khoa học: "Discovering Global Patterns in Linguistic Networks through Spectral Analysis: A Case Study of the Consonant Inventories" pdf

Tài liệu Báo cáo khoa học: "Discovering Global Patterns in Linguistic Networks through Spectral Analysis: A Case Study of the Consonant Inventories" pdf

... clear from these rules that the split into C − and C + has taken place mainly based on whether the consonants have the combined “dental alveolar” feature (negative class) or the “dental” and the ... the entire range of a variable into smaller intervals and counting the number of observations within each bin or interval. In fixed binning, all the intervals are of th...

Ngày tải lên: 22/02/2014, 02:20

9 703 1
Báo cáo khoa học: "Factorizing Complex Models: A Case Study in Mention Detection" pdf

Báo cáo khoa học: "Factorizing Complex Models: A Case Study in Mention Detection" pdf

... a trivial task: the data just gets added to the train- ing data, and the model is retrained. For the AIO model, we have build another mention classifier on the additional training data, and labeled the ... the original training data T . Then we train the all- in- one classifier on the original training data T , adding the features defined on the output of ap- plying...

Ngày tải lên: 08/03/2014, 02:21

8 554 0
Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx

Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx

... belonging to a particular in ection class. For example, in Czech (as in many other in- flective languages), the nominative, the accusative and the vocative case have the same form (in sin- gular ... tags 1 Mainly because of the ease with which it is trained even on large data, and also because no other publicly available tagger was able to cope with the amount and...

Ngày tải lên: 08/03/2014, 05:20

8 519 0
Báo cáo khoa học: "Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study" potx

Báo cáo khoa học: "Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study" potx

... denoting the corpus with the desired stan- dard. And correspondingly, the two annotation standards are naturally denoted as source standard and target standard, while the classifiers follow- ing the ... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 522–530, Suntec, Singapore, 2-7 August 2009. c 2009 ACL and AFNLP Automatic A...

Ngày tải lên: 17/03/2014, 01:20

9 404 0
Báo cáo khoa học: Rapamycin inhibits lipopolysaccharide induction of granulocyte-colony stimulating factor and inducible nitric oxide synthase expression in macrophages by reducing the levels of octamer-binding factor-2 doc

Báo cáo khoa học: Rapamycin inhibits lipopolysaccharide induction of granulocyte-colony stimulating factor and inducible nitric oxide synthase expression in macrophages by reducing the levels of octamer-binding factor-2 doc

... in macrophages and its underlying mechanism. The study arose from an observation that rapamycin inhibited the LPS-induced increase in octamer-binding factor-2 (Oct-2) protein levels through a ... rapamycin on the LPS-induced increase in iNOS and G-CSF mRNA levels. Chromatin immunoprecipitation assays showed that LPS enhanced the binding of Oct-2 to the iNOS and G-CSF...

Ngày tải lên: 22/03/2014, 17:20

12 377 0
Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

... (5¢-CCGGCATTGAGGATGCTGAT- 3¢) for the sense-strand template, the other with forward primer matGIHF (5¢-AACATCCTGGACAGCAAATGCA GGG-3¢) and T7-containing reverse primer (5¢-TAATACG ACTCACTATAGGGAGACCGGCA ... Katayama H, Tominaga S, Takasuka T, Nakatsuji T, Sonobe T, Aida K & Nagasawa H (2005) Cloning and characterization of a molt-inhibiting hormone-like peptide from the prawn M...

Ngày tải lên: 23/03/2014, 07:20

11 369 0
w