Báo cáo "Numerical study of long wave runup on a conical island " pdf

... evolution and runup of long waves on a slopingbeach is a classicalproblem of hydrodynamics.Itis usuallyrelatedwiththecalculation of coastal effects of long waves such as tide and tsunami. ... the FiniteVolumeMethod.Themodelwas appliedto the study of long wave propagationand runup on a conical island.  The simulated results by the model were compared...

Ngày tải lên: 14/03/2014, 15:20

...

Ngày tải lên: 13/02/2014, 12:20

... simulation period of 126h. Maximum change takes place at the Nam Trieu channel area from Nha Mac to Aval Light where 0.006m of accretion occurs. Accretion also takes place at the south of Cong ... waves, and interaction of these processes including wave transformation and breaking [2]. Radiation stress gradients from the wave model are mapped to the circulation model for c...

Ngày tải lên: 14/03/2014, 15:20

...

Ngày tải lên: 22/03/2014, 11:20

... the weatheringcrustinplantareaandthenuseitas a base to compare  and make recommendation forthe study area. 3. Study results Theoretically, analyzing the weathering factorsallowsustoremark: ‐Thebedrockisanindependentfactorand it ... Ky Son,CaoPhong,andHoaBinhTown.Based on the weathering crust rese arch,  the suitabilit y of land for cha...

Ngày tải lên: 22/03/2014, 12:20

... loss of ara4dHex, but no destruction of the other monosaccharides. Methylation analysis of OPS-I and OPS-II by GLC-MS of the partially methylated alditol acetates (Table 1) revealed terminal ara4dHex, ... partial cleavage of terminal ara4dHex during isolation of the OPS by mild acid degradation of the LPS. The fully methylated derivative of ara4dHex had the same GLC retention...

Ngày tải lên: 23/03/2014, 17:22

... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites of ... S, Khachatr- yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotoga maritima stationary phase survival protein SurE: a novel acid pho...

Ngày tải lên: 18/02/2014, 14:20

... representation of the tectogrammatical an- notation of a sentence is a rooted dependency tree. It consists of a set of nodes and a set of edges. One of the nodes is marked as a root. Each node is a ... as an Annotation Query Lan- guage: a Use Case Analysis. In: Proceedings of the Third International Conference on Language Re- sources and Evaluation, Canary Isla...

Ngày tải lên: 08/03/2014, 01:20

... overall per- formance against training data, it not only adapts to any application domain but. also may avoid over- fitting to the data. In the late 80s and early 90s, the induction and parameter ... can use arbitrary numbers of the attributes which potentially increase parsing accu- racy. Natural languages are full of exceptional and collo- cational expressions. It is difficult f...

Ngày tải lên: 23/03/2014, 19:20

... HLL approximate Riemann solver for the determination of numerical fluxes at cell interfaces. The model was applied to the simulation of long wave propagation and runup on a plane beach and ... engineers face to problems related to the simulation or determination of wave runup in general, and long wave runup in particular for practical purposes, such as design o...

Ngày tải lên: 22/03/2014, 12:20