0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "A Strategy for Dynamic Interpretation: a Fragment and an Implementation" pot

Báo cáo khoa học:

Báo cáo khoa học: "A Strategy for Dynamic Interpretation: a Fragment and an Implementation" pot

... subscripts and superscripts is necessary because noun phrases can act as anaphors and an- tecedents at the same time. (4) A man I walked in. Another man~ walked ont. Hez was angry. In example ... phrase another man is anaphorically constrained by an antecedent noun phrase a man (it must have a different referent), and at the same time acts as antecedent for the second occurrence of a ... Netherlands Abstract The strategy for natural language interpre- tation presented in this paper implements the dynamics of context change by translat- ing natural language texts into a meaning...
  • 10
  • 365
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Topic Models for Dynamic Translation Model Adaptation" pptx

... Models for Dynamic Translation Model AdaptationVladimir EidelmanComputer Science and UMIACSUniversity of MarylandCollege Park, MDvlad@umiacs.umd.eduJordan Boyd-GraberiSchool and UMIACSUniversity ... MarylandCollege Park, MDjbg@umiacs.umd.eduPhilip ResnikLinguistics and UMIACSUniversity of MarylandCollege Park, MDresnik@umd.eduAbstractWe propose an approach that biases machinetranslation ... translation over a strongbaseline.1 IntroductionThe performance of a statistical machine translation(SMT) system on a translation task depends largelyon the suitability of the available parallel...
  • 5
  • 532
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "ADOP Model for Semantic Interpretation*" pdf

... the ba- sis of a type-lattice, called a frame structure. The interpretation of an utterance, is an update of an information state. An information state is a repre- sentation of objects and ... containing a lot of clearly ungrammatical utterances. For the annotation task, the annotation 4Netherlands Organization for Scientific Research 5Public Transport Information System workbench SEMTAGS ... semantically analyzed corpora (ATIS and OVIS). 2 Data-Oriented Syntactic Analysis So far, the data-oriented processing method has mainly been applied to corpora with simple syntac- tic annotations,...
  • 9
  • 348
  • 0
Báo cáo khoa học: The dipeptidyl peptidase IV family in cancer and cell biology pot

Báo cáo khoa học: The dipeptidyl peptidase IV family in cancer and cell biology pot

... lymph node, spleen, liver and lung,as well as in pancreatic acinar cells, adrenal gland,spermatogonia and spermatids of testis, and in Pur-kinje cells and in the granular layer of cerebellum. Theresults ... epithelial cells of a large numberof organs, including liver, gut and kidney; by endothe-lial capillaries; by acinar cells of mucous and salivaryglands and pancreas; by the uterus; and by immuneorgans ... Research Council ofAustralia for a postgraduate scholarship to DMTY and grants to MDG and GWM. TWY and NAN holdAustralian Postgraduate Awards.References1 Cunningham DF & O’Connor B (1997)...
  • 19
  • 468
  • 0
Báo cáo khoa học: Thiaminylated adenine nucleotides Chemical synthesis, structural characterization and natural occurrence potx

Báo cáo khoa học: Thiaminylated adenine nucleotides Chemical synthesis, structural characterization and natural occurrence potx

... for AThTP and AThDP, together withthose for ThTP and ThDP, are listed in Table 1. Theyare clearly in accordance with the presence in AThDP and AThTP of a thiamine and an adenine moiety, ascompared ... toAMP) and m ⁄ z 257.1. We were unable to assign thelatter ion, which is obtained after fragmentation ofboth AThTP and AThDP and probably results from a molecular rearrangement.NMR data for ... min, and AThDPwas eluted after 14 min. The peaks were collected, lyophi-lized and used for MS analysis and NMR.Identification of AThTP and AThDP by ESItandem MSExperiments were performed on a...
  • 13
  • 297
  • 0
Báo cáo khoa học: Short hydrogen bonds in proteins Sathyapriya Rajagopal and Saraswathi Vishveshwara pot

Báo cáo khoa học: Short hydrogen bonds in proteins Sathyapriya Rajagopal and Saraswathi Vishveshwara pot

... S. Rajagopal and S. Vishveshwara1830 FEBS Journal 272 (2005) 1819–1832 ª 2005 FEBS(December 2003). We thank Sanjeev B.S. and Anandhi S. for useful discussions on technical details and acknow-ledge ... sheet; (e) between a strand and helix; and (f) between the side chains Arg452 and Glu437 of strands.Short hydrogen bonds in proteins S. Rajagopal and S. Vishveshwara1828 FEBS Journal 272 (2005) ... Vishveshwara S, Madhusudhan MS, Maizel JV Jr(2001) Short-strong hydrogen bonds and a low barriertransition state for the proton transfer reaction inRNase A catalysis: a quantum chemical study....
  • 14
  • 421
  • 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... the a, b and c subunits of theenzyme are abbreviated as a D, bD, and cD, respectively, and the a and b subunits of the reactivase are abbrevi-ated as a R and bR, respectively, molar ratios ... K, Hieda N, Yamanishi M, Shibata N &Toraya T (2005) Crystallization and preliminary X-rayanalysis of molecular chaperone-like diol dehydratase-reactivating factor in ADP-bound and nucleotide-freeforms. ... (an inactive coenzyme analog lacking the ade-nine ring in the upper axial ligand; a model of damagedcofactors) for free adeninylpentylcobalamin (AdePeCbl) (an inactive coenzyme analog containing...
  • 13
  • 620
  • 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

... short forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R)12 reverse CAAGGAGCGTTAGAATCTAAAG H1R13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R)14 reverse GATTTAAGTGGAGCGGAATGCTA ... enzymes:quantitative and qualitative.The quantitative properties (concentration and, as a consequence, total activity) of an enzyme can be chan-ged by affecting rates of transcription and ⁄ or transla-tion ... b-subunitscorrespondingly translated from mRNA a ldh a and mRNAbldh a isoforms (LDH -A mRNAratios shown in the embedded histogram),assuming similar translational activity ofboth mRNA isoforms and a random assem-bly...
  • 11
  • 662
  • 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

... zero and the negativesubgraph is upheld.n-Reaction subgraphs. We can now formulate the proper-ties of any negative subgraph t hat contains an arbitraryequal number of species and reactions. ... Ministry of Science and Technology of the Spanish Government (SAF 2002–02785), INTASgrant (97–1504), and the Netherlands’ Organization for ScientificResearch. We t hank T. Sukhomlin for disc ussions.References1. ... Graph 1 (these paths may containparallel and antiparallel arrows). The sign of that elementtherefore depends on the both the sign and the magnitudesof these influen ce paths (see below). If all...
  • 11
  • 638
  • 0
Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

... lack of a bacterial cell wall and a parasiticlifestyle [4].Some species of the genus mycoplasma, e.g. Myco-plasma genitalium, Mycoplasma gallisepticum and Mycoplasma pneumoniae exhibit a flask-like ... sequence was obtained from the single charged y -fragment ions (…) and the b -fragment ions(– –). Calculated from the b1 fragment and the y 28 fragment, the N-terminal amino acid consists of asparagine ... Experimental proof for a signal peptidase I like activityin Mycoplasma pneumoniae, but absence of a geneencoding a conserved bacterial type I SPaseIna Catrein, Richard Herrmann, Armin Bosserhoff and...
  • 9
  • 559
  • 1

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015