Báo cáo khoa học: "A Strategy for Dynamic Interpretation: a Fragment and an Implementation" pot

... subscripts and superscripts is necessary because noun phrases can act as anaphors and an- tecedents at the same time. (4) A man I walked in. Another man~ walked ont. Hez was angry. In example ... phrase another man is anaphorically constrained by an antecedent noun phrase a man (it must have a different referent), and at the same time acts as antecedent for the secon...

Ngày tải lên: 09/03/2014, 01:20

... Models for Dynamic Translation Model Adaptation Vladimir Eidelman Computer Science and UMIACS University of Maryland College Park, MD vlad@umiacs.umd.edu Jordan Boyd-Graber iSchool and UMIACS University ... Maryland College Park, MD jbg@umiacs.umd.edu Philip Resnik Linguistics and UMIACS University of Maryland College Park, MD resnik@umd.edu Abstract We propose an approach that bi...

Ngày tải lên: 19/02/2014, 19:20

... the ba- sis of a type-lattice, called a frame structure. The interpretation of an utterance, is an update of an information state. An information state is a repre- sentation of objects and ... containing a lot of clearly ungrammatical utterances. For the annotation task, the annotation 4Netherlands Organization for Scientific Research 5Public Transport Information...

Ngày tải lên: 22/02/2014, 03:20

... lymph node, spleen, liver and lung, as well as in pancreatic acinar cells, adrenal gland, spermatogonia and spermatids of testis, and in Pur- kinje cells and in the granular layer of cerebellum. The results ... epithelial cells of a large number of organs, including liver, gut and kidney; by endothe- lial capillaries; by acinar cells of mucous and salivary glands and pancreas;...

Ngày tải lên: 06/03/2014, 09:22

... for AThTP and AThDP, together with those for ThTP and ThDP, are listed in Table 1. They are clearly in accordance with the presence in AThDP and AThTP of a thiamine and an adenine moiety, as compared ... to AMP) and m ⁄ z 257.1. We were unable to assign the latter ion, which is obtained after fragmentation of both AThTP and AThDP and probably results from a molecular r...

Ngày tải lên: 07/03/2014, 01:20

... S. Rajagopal and S. Vishveshwara 1830 FEBS Journal 272 (2005) 1819–1832 ª 2005 FEBS (December 2003). We thank Sanjeev B.S. and Anandhi S. for useful discussions on technical details and acknow- ledge ... sheet; (e) between a strand and helix; and (f) between the side chains Arg452 and Glu437 of strands. Short hydrogen bonds in proteins S. Rajagopal and S. Vishveshwara 1828 F...

Ngày tải lên: 07/03/2014, 17:20

... the a, b and c subunits of the enzyme are abbreviated as a D , b D , and c D , respectively, and the a and b subunits of the reactivase are abbrevi- ated as a R and b R , respectively, molar ratios ... K, Hieda N, Yamanishi M, Shibata N & Toraya T (2005) Crystallization and preliminary X-ray analysis of molecular chaperone-like diol dehydratase- reactivating factor in A...

Ngày tải lên: 15/02/2014, 01:20

... short forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R) 12 reverse CAAGGAGCGTTAGAATCTAAAG H1R 13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R) 14 reverse GATTTAAGTGGAGCGGAATGCTA ... enzymes: quantitative and qualitative. The quantitative properties (concentration and, as a consequence, total activity) of an enzyme can be chan- ged by affecting rates of transc...

Ngày tải lên: 19/02/2014, 02:20

... zero and the negative subgraph is upheld. n-Reaction subgraphs. We can now formulate the proper- ties of any negative subgraph t hat contains an arbitrary equal number of species and reactions. ... Ministry of Science and Technology of the Spanish Government (SAF 2002–02785), INTAS grant (97–1504), and the Netherlands’ Organization for Scientific Research. We t hank T. Sukhomlin f...

Ngày tải lên: 19/02/2014, 16:20

... lack of a bacterial cell wall and a parasitic lifestyle [4]. Some species of the genus mycoplasma, e.g. Myco- plasma genitalium, Mycoplasma gallisepticum and Mycoplasma pneumoniae exhibit a flask-like ... sequence was obtained from the single charged y -fragment ions (…) and the b -fragment ions (– –). Calculated from the b1 fragment and the y 28 fragment, the N-terminal ami...

Ngày tải lên: 19/02/2014, 18:20