Báo cáo khoa học: "A Descriptive Framework for Translating Speaker''''''''s Meaning Towards a Dialogue Translation System between Japanese and English" pot

Báo cáo khoa học: "A Descriptive Framework for Translating Speaker''''s Meaning Towards a Dialogue Translation System between Japanese and English" pot

... A Descriptive Framework for Translating Speaker's Meaning - Towards a Dialogue Translation System between Japanese and English - Masako KUME Gayle K. SATO ATR Interpreting ... Speaker's meaning translation procedure As a grammar for surface-level analysis, we have adopted HPSG (Pollard and Sag 1987) and JSPG (Gunji 1987), that is a modification of the former for dealing ... INFORMATIVR various S-INFORM 3.2.Unification-based analysis Figure 1 diagrams an overview of the procedure for translating speaker's meaning. In contrast to a conventional machine translation...

Báo cáo khoa học: "An IR Approach for Translating New Words from Nonparallel, Comparable Texts" pot

... vice versa. In a source-target language translation scenario, the translated text can be "rearranged" and cleaned up by a monolingual language model in the tar- get language. However, ... with a * indicates that it is a word with segmentation and translation ambiguities. For example, (Lam) could be a family name, or part of an- other word meaning forest. When it is used as a ... An IR Approach for Translating New Words from Nonparallel, Comparable Texts Pascale Fung and Lo Yuen Yee HKUST Human Language Technology Center Department of Electrical and Electronic...

Tài liệu Báo cáo khoa học: Properties of ecdysteroid receptors from diverse insect species in a heterologous cell culture system – a basis for screening novel insecticidal candidates docx

... the bandsignal was determined for the deﬁned band area and adjustedrelative to one of the signals, as designated, to calculate therelative band density.Vector description and constructionAll ... M, Castaldo C, Rog-ers D, Mahoney M & Wollam J (2007) Resistance and cross-resistance to imidacloprid and thiamethoxam inthe Colorado potato beetle Leptinotarsa decemlineata .Pest Manag ... Press, Oxford, UK.31 Ogura T, Minakuchi C, Nakagawa Y, Smagghe G &Miyagawa H (2005) Molecular cloning, expression anal-ysis and functional conﬁrmation of ecdysone receptor and ultraspiracle...

Tài liệu Báo cáo khoa học: "Discriminative Lexicon Adaptation for Improved Character Accuracy – A New Direction in Chinese Language Modeling" pptx

... replaced by characters, we cantreat words as a means to enhance character recog-nition accuracy. Such arguments stand at least for Chinese ASR since they evaluate on character errorrate and ... parts randomly: 5K as the adaptation corpus and 5K as the testing set. We show the ASR char-acter accuracy results after lexicon adaptation bythe proposed approach in Table 3.LAICA-1 LAICA-2 A ... increased character accuracy to the relat iveincreased MAP for the three lexicon adaptation ap-proaches are different. A key factor making theproposed LAICA approach advantageous is thatwe...

Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

... plants. NatBiotechnol 18, 666–669.36 Rosati C, Aquilani R, Dharmapuri S, Pallara P,Marusic C, Tavazza R, Bouvier F, Camara B &Giuliano G (2000) Metabolic engineering of beta-carotene and ... reveals a novel cleavage pattern,cytosolic localization and induction by highlight. MolMicrobiol 69, 231–244.41 Prado-Cabrero A, Estrada AF, Al-Babili S & Avalos J(2007) Identiﬁcation and ... Sitrit Y, Bar E, Azulay Y, Meir A, ZamirD & Tadmor Y (2005) Carotenoid pigmentation affectsthe volatile composition of tomato and watermelonfruits, as revealed by comparative genetic analyses.J...

Báo cáo khoa học: "Phrase Table Training For Precision and Recall: What Makes a Good Phrase and a Good Phrase Pair?" doc

... approaches ofbuilding a phrase translation table and show the ﬁ-nal translation results. We measure translation per-formance by the BLEU (Papineni et al., 2002) and METEOR (Banerjee and Lavie, ... retrieval, precision and recall issues need to be addressed with a rightbalance for building a phrase translation table. Highprecision requires that identiﬁed translation candi-dates are accurate, ... PhraseTableBLEUPhrasetable SizeFigure 1: Thresholding effects on translation perfor-mance and phrase table sizethat the translation performance improves gradually.After reaching its peak,...

Báo cáo khoa học: "Generating Usable Formats for Metadata and Annotations in a Large Meeting Corpus" pptx

... generate tab-ular ﬁles (TSV) and a table-creation script(db loader.sql).3. Create and populate the annotation database.4. Adapt the XSLT stylesheets as needed for vari-ous annotations and/ or table ... order to generate tabular ﬁles(TSV) and a table-creation script.4. Create and populate metadata tables withindatabase.5. Adapt the XSLT stylesheet as needed for vari-ous table formats.5 Results: ... usabilityof this important resource, a representationformat based on relational databases is pro-posed, which maximizes informativeness,simplicity and reusability of the metadata and annotations....

Báo cáo khoa học: "What do we know about medication errors made via a CPOE system versus those made via handwritten orders"

... with dosages. Idiscuss these issues and their implications for the evaluation ofCPOE systems and of other emerging healthcare technologies.Shulman and colleagues [1] have contributed a thoughtfulstudy ... physician order entry; DSS = decision support system. Available online http://ccforum.com/content/9/5/427AbstractThis commentary on the article by Shulman et al. examines what weunderstand by ... non-intercepted medication errors (potential and actualerrors), the CPOE system was associated with fewer errors, a finding they repeatedly stress. When they examined majormedication errors, however,...

Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

... 27Data are expressed as means ± standard deviation, unless stated otherwise. APACHE, Acute Physiology and Chronic Health Evaluation; ICU, intensive care unit; IQR, interquartile range; SAPS, ... analysis of thestudy. MS conceived and coordinated the study and wasinvolved in the interpretation of the data and manuscript revi-sion. All authors read and approved the final manuscript.AcknowledgementsAll ... iMDsoft,Sassenheim, The Netherlands) and searched the hospitalinformation system for the following: orders for sputum cul-tures or performance of a bronchoalveolar lavage for culture,or start of...

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a ... CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 ... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS Journal 278 (2011) 2913–2926 ª 2011 The Authors Journal compilation ª 2011...

Xem thêm