Báo cáo Y học: Mycobacterium tuberculosis FprA, a novel bacterial NADPH-ferredoxin reductase docx
Báo cáo Y học: Mycobacterium tuberculosis FprA, a novel bacterial NADPH-ferredoxin reductase docx
... [13]. Activity assays Enzyme catalyzed reactions were monitored continuously on a Hewlett-Packard 8453 diode-array spectrophotometer. Ferric reductase activity was assayed in both aerobic and anaerobic ... Mycobacterium tuberculosis FprA, a novel bacterial NADPH-ferredoxin reductase Federico Fischer, Debora Raimondi, Alessandro Aliverti and Giuliana Zanetti Dipartimento di...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3rev- Gulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3¢. The PCR product was cloned into ... cerevisiae D-arabinono-1,4-lactone oxidase (ALO), P54783; Candida albicans D-arabinono-1,4-lactone oxidase (ALO), O93852; Neurospora crassa, Q7SGY1; Gibberella zeae, XP_388870; Ara...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo Y học: Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge pptx
... is probably the translational start site because it is followed by a typical signal peptide motif with a basic residue (lysine) and a hydrophobic region (rich in valine and alanine) and matches ... performed by Edman degra- dation (PE Applied Biosystems, model 47 3A) on native and on reduced and pyridylethylated peptides. Bacterial challenge of white bass and RNA sampling The challeng...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo y học: "Do we need a critical care ultrasound certification program? Implications from an Australian medical-legal perspective"
... well-recognized and widely accepted in Australia and New Zealand, the Australasian Society of Ultrasound in Medicine. Conclusion Medical practitioners owe a duty of care, arising from contract and/or ... ‘neighbour’ and the doctor must act reasonably to avoid any foreseeable risks that may cause harm to his/her patient. When a hospital accepts a patient, the hospital (including th...
Ngày tải lên: 25/10/2012, 10:02
Báo cáo y học: "Spinal Intramedullary Cysticercosis: A Case Report and Literature Review"
... anatomically as extraspinal (vertebral) or intraspinal (epidural, subdural, arachnoid, or intramedullary), of which the intramedullary type is quite rare and only fifty-three cases have been ... clinical manifestations included pain, paraparesis, spasticity, bowel and bladder in- continence, and sexual dysfunction 1,20 . However, in- flammatory reaction against the dead parasite is as- s...
Ngày tải lên: 25/10/2012, 10:56
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey Adalet Altunsoy 1 , Cenk Aypak 2 , Alpay Azap 1 , Önder ... data- bases, and 2) International Medication System (IMS). Because Turkey is an inflation country we have esca- lated all antibiotic prices. The cost of antibiotics was calculated as US dollars...
Ngày tải lên: 25/10/2012, 11:00
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"
... Fatema Hasan Mahatma Gandhi Mission’s Medical College, Aurangabad, Maharastra, India, 431003 Correspondence to: Hunaid Hasan or Tasneem Fatema Hasan, “Ezzi Manzil”, CTS No. 3910, Near Bombay Mercantile ... 3910, Near Bombay Mercantile Bank, Beside Amodi Complex, City Chowk, Juna Bazaar, Aurangabad, Maharashtra, India 431001. Email: hunaidhasan@hotmail.com or zainabhasan52@hotmail.com. P...
Ngày tải lên: 26/10/2012, 09:57
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... similarities with several products from the pur cluster of S. alboniger [6]. They were accordingly named ataP3, ataP5, ataP4, ataP10 and ataP7. The two additional ones were named ata12 and ataPKS1 ... positive aerobic and anaerobic bacteria and most Gram negative anaerobic species. In contrast, it has a low toxicity for aerobic Gram negative bacteria, some fungi and mammals [2]. Its chemica...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx
... the regulatory subunit of casein kinase 2 in Drosophila melanogaster Alla I. Kalmykova 1 , Yuri Y. Shevelyov 1 , Oksana O. Polesskaya 1, *, Anna A. Dobritsa 1, †, Alexandra G. Evstafieva 2 , Brigitte ... quantitative and qualitative assays for b-galactosidase (activation of LacZ reporter gene). BD, pGBT9; BD*, pAS2-1; AD, pGAD424; AD**, pACT2. Activity values are given as mean values ± stand...
Ngày tải lên: 21/02/2014, 15:20
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... franciscana Oligomerization and thermotolerance Julie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRae Department of Biology, Dalhousie University, Halifax, Nova Scotia, Canada Oviparously ... GCGCGGATCCACCATGCCCTTCCGGAGAAGA 468/156 (p26-192Xho-as) CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT p26-ND60 1–60 (p26-60Bam-s) GCGCGGATCCACCATGTCCTTGAGGGACACA 396/132 (p26-192Xho-as) CGCGCCTCGAGTTAAGCTGCACCTC...
Ngày tải lên: 22/02/2014, 04:20