Báo cáo Y học: Substrates modulate the rate-determining step for CO binding in cytochrome P450cam (CYP101) A high-pressure stopped-flow study pdf

Báo cáo Y học: Substrates modulate the rate-determining step for CO binding in cytochrome P450cam (CYP101) A high-pressure stopped-flow study pdf

Báo cáo Y học: Substrates modulate the rate-determining step for CO binding in cytochrome P450cam (CYP101) A high-pressure stopped-flow study pdf

... Substrates modulate the rate-determining step for CO binding in cytochrome P450cam (CYP101) A high-pressure stopped-flow study Christiane Jung 1 , Nicole Bec 2 and Reinhard Lange 2 1 Max-Delbru ¨ ck-Center ... that the observed rate constant for the CO binding is linearly related to the CO concentration indicating bimolecular binding kinetics [...

Ngày tải lên: 08/03/2014, 23:20

8 454 0
Báo cáo y học: "Enhancement of the Click Chemistry for the Inverse Diels Alder Technology by Functionalization of Amide-Based Monomers"

Báo cáo y học: "Enhancement of the Click Chemistry for the Inverse Diels Alder Technology by Functionalization of Amide-Based Monomers"

... and the N-ethyl-diisoproylamine and the dansyl sulfamidoethylamine to the tetrazine product 7 linked with 5-dansyl sulfamidoethylcarboxamide-2-yl. 4. For the syntheses of the polyamide-based ... building blocks as favourites for intracellular delivery and targeting applications. This allows local drug concentrations sufficient for imaging and therapy and simultaneously...

Ngày tải lên: 25/10/2012, 11:00

10 756 0
Báo cáo y học: " Factors affecting the long-term response to tacrolimus in renal transplant patients: Pharmacokinetic and pharmacogenetic approac"

Báo cáo y học: " Factors affecting the long-term response to tacrolimus in renal transplant patients: Pharmacokinetic and pharmacogenetic approac"

... the amount of CYP 3A5 protein accurately as it can be affected by other factors, genetic (expression of m-RNA, stability of CYP 3A5 protein, dual metabolic pathway via CYP 3A4 and CYP 3A5 , linkage ... demanding in the quantity of available data. In the LR analysis, the kinetic parameters were modeled based on sex, presence of CYP 3A5 *1 allele, age at transplantation (<4...

Ngày tải lên: 26/10/2012, 09:32

7 787 0
Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

... 29 base DNA 13 -RNA 4 -DNA 12 (5¢-AATA GAGAAAAAGaaaaAAGATGGCAAAG-3¢) and DNA 15 - RNA 1 -DNA 13 (5¢-AATAGAGAAAAAGAAaAAAGATG GCAAAG-3¢) with a 1.5 molar equivalent of the comple- mentary DNA, respectively, ... 5¢-TG TG GAATTCAGTGGTGGTGGTGGTGGTGCCGGTAC CAATTATCTAGGG-3¢ for RNH 2A- R; 5¢-ATAT GAA TTCTCTCTAAGGAGATATACTTAT GACCGTTTC CAA CATTGGG-3¢ for RNH2B-F; 5¢-GGGG AAGCTTCTA GTGGTGGTGGT...

Ngày tải lên: 17/03/2014, 17:20

14 483 0
Báo cáo y học: "Use of the measure your medical outcome profile (MYMOP2) and W-BQ12 (Well-Being) outcomes measures to evaluate chiropractic treatment: an observational study"

Báo cáo y học: "Use of the measure your medical outcome profile (MYMOP2) and W-BQ12 (Well-Being) outcomes measures to evaluate chiropractic treatment: an observational study"

... chiropractors in a clinical teaching facility. The W-BQ12 was also used as a tool to assess the validity of the well being component of the MyMOP2 against the validated W-BQ12 instrument in this clinical ... chiropractic intervention was contraindi- cated such as fracture, infection e.g. septic arthritis or malignancy; any additional physical treatment for their complaint...

Ngày tải lên: 25/10/2012, 10:06

8 539 0
Báo cáo y học: "Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya"

Báo cáo y học: "Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya"

... (Indianapolis, Indiana). Informed consent was obtained for key informant inter- views, and all clinical investigation was conducted accord- ing to the principles expressed in the Declaration of Helsinki. Study ... disconfirming the codes and the subse- quent themes. Data triangulation was used by comparing the information reported in the interview dialogue with clinic info...

Ngày tải lên: 25/10/2012, 10:31

10 696 0
Báo cáo y học: "Evaluation of the Prevalence of Concomitant Idiopathic Cyclic Edema and Cellulit"

Báo cáo y học: "Evaluation of the Prevalence of Concomitant Idiopathic Cyclic Edema and Cellulit"

... difficulty in removing rings on waking in the morning which improves later in the day. All patients with cyclic edema were treated with 75 mg aminaphtone three times daily. Statistical analysis con- sidered ... rings on waking in the morning which im- proves later in the day. Some patients reported facial edema early in the morning and swelling of the legs at the...

Ngày tải lên: 25/10/2012, 10:51

3 463 1
Báo cáo y học: "Placenta Percreta-Induced Uterine Rupture Diagnosed By Laparoscopy in the First Trimester"

Báo cáo y học: "Placenta Percreta-Induced Uterine Rupture Diagnosed By Laparoscopy in the First Trimester"

... be evaluated for the differential diagnosis such as appendicitis and hemoperitoneum. The gradual increase in the size of the uterus with advancing pregnancy can cause a delay in the diagnosis ... bleeding was detected; therefore, total abdominal hysterectomy was performed. The patient was discharged without any complications. Pathological analysis of the uterine spec...

Ngày tải lên: 25/10/2012, 10:56

4 503 0
 Báo cáo y học: " Efficacy of the Valsalva Maneuver on Needle Projection Pain and Hemodynamic Responses During Spinal Puncture"

Báo cáo y học: " Efficacy of the Valsalva Maneuver on Needle Projection Pain and Hemodynamic Responses During Spinal Puncture"

... needle insertion including infiltration analgesia and EMLA patch. Local anesthetics themselves may pro- duce pain on injection and many anesthetists are un- sure that infiltration analgesia at the ... effect of the Valsalva maneuver on pain. 6-10 In a study by Agrawal et al, Valsalva maneuver performed before venous canulation could decrease the incidence and severity of pain a...

Ngày tải lên: 25/10/2012, 11:15

5 514 0
Báo cáo y học: "Extension of the PNA world by functionalized PNA monomers eligible candidates for inverse Diels Alder Click Chemistyr"

Báo cáo y học: "Extension of the PNA world by functionalized PNA monomers eligible candidates for inverse Diels Alder Click Chemistyr"

... The reaction batch was stirred continu- ously over night and the reaction’s completeness was ex- amined using thin-layer chromatography. The yellow col- oured product was concentrated by rotary ... quality. Also in future pharmacological applications, as yet im- practicable, this example could establish a platform for expanded use in the PNA, the DNA and the RNA world. C...

Ngày tải lên: 26/10/2012, 08:57

11 503 0
w