Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot
... cphA:forward,GCGATA CCATGG TATCCGAATTCCAAG and reverse, ACCCGG GTCG ACTCAGTGATGGTGGTGATGGTGTCCTCGACC AAAAAGATC; rcpA:forward,GCGATA GAATTCATG AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; ... CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; cphB:forward,GCGATA GAATTC ATG ACGAATTGCGATCGCGA and reverse, ACCCGG GTCGACTCAGTGATGGTGGTGATGGTGTTTGAC CT...
Ngày tải lên: 08/03/2014, 23:20
... quality assurance survey Natalie Chahine-Malus, Thomas Stewart, Stephen E Lapinsky, Ted Marras, David Dancey, Richard Leung and Sangeeta Mehta Mount Sinai Hospital, Toronto, Ontario, Canada Correspondence: ... beneficial to patient care. Brainsky et al observed that 20% of routine CXRs performed in a medical ICU had ‘major important’ findings, and 8% prompted a change in management [...
Ngày tải lên: 25/10/2012, 10:45
... “mesiodens”, anamnestically deter- mined a familial predisposition in 31% of cases 6 . Su- pernumerary teeth are frequently found in the supe- rior maxillary bone and mainly in the premaxilla (90-98%) ... and symptomatology. • Tumefaction on the vestibular or pala- tine/lingual area. Hyperdontia therapy depends on the area and on the number of teeth in excess (erupted into prope...
Ngày tải lên: 25/10/2012, 11:40
Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"
... in a large case-control study that was incorporated into a nationwide mortality survey in China in 1989–1991. As an example, we assessed the hazards of tobacco use on smoking-related cancer ... patterns in urban and rural areas was used as a surrogate analy- sis by socioeconomic status. In conclusion, the basic principles of equivalence are also supported by epidemiologi...
Ngày tải lên: 26/10/2012, 09:48
Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"
... Japanese patients with esophageal squamous cell carcinoma Akiko Kuwahara 1 , Motohiro Yamamori 2 , Kohshi Nishiguchi 3,4 , Tatsuya Okuno 3 , Naoko Chayahara 3 , Ikuya Miki 3 , Takao Tamura 3 , ... 3 , Tsubasa Inokuma 2 , Yoshiji Takemoto 2 , Tsutomu Nakamura 3 , Kazusaburo Kataoka 1 and Toshiyuki Sakaeda 2,3 1. School of Pharmacy and Pharmaceutical Sciences, Mukogawa Wom...
Ngày tải lên: 26/10/2012, 09:53
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
... AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized ... Quantity and duration of episodes and the associated symptoms. Panel B: Detraction in daily life generally and in parts of daily life. AVNRT AVRT EAT variable Value N % N % N % PAN...
Ngày tải lên: 03/11/2012, 11:44
Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx
... done. Whereas SC is readily secreted without assembly with the other components, this is not the case for a1 heavy-chain and J-chain. Both are retained and degraded intracellularly unless in complex ... absorbance was read by TitertekÒ Multiskan (ICN Flow, USA). The amount of IgA present in each supernatant was calculated relative to a standard preparation with known concentration. Ver...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk
... initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary ar- tery disease (CAD; 4). Also the safety and ... included major adverse cardiac events (MACE) at two year (MACE: Death, myocardial infarction, target vessel revascularization (TVR). Target vessel revasculariza- tion was defined as being ei...
Ngày tải lên: 25/10/2012, 11:18
Báo cáo y học: " Two-stage procedure in the treatment of late chronic hip infections spacer"
... infections. Infection was successfully eradicated in 100 patients (87.7%) at a mean follow-up of two years. Spacers Spacers are classified as static or non-articulating spacers, medullary dowels, and ... clinical presentation, the findings on physical examination and the interpretation of relevant inves- tigations. The treatment goals are to attempt limb salvage and preserve joint...
Ngày tải lên: 26/10/2012, 09:53
Báo cáo Y học: Two different E2F6 proteins generated by alternative splicing and internal translation initiation ppt
... 5¢-GGGAATTCTCAGATAGAGTCTTCTCTGG GAGC-3¢ SG50: 5¢-GGGGACCAGGGTGACCGCGG-3¢ SG92: 5¢-GCGCGGGAGATCTAACGGACGG-3¢ SG108: 5¢-CCTCTAGACGCGCCGTCCGGTGCTGAC TCAT-3¢ SG109: 5¢-GGGGATCCATGCCATCAAAAATAAGGA TTAAT-3¢ SG142: ... points after serum addition. Synchronization was confirmed by FACS analysis. RNA isolation Total RNA was isolated from primary MEFs with the RNeasy kit (Qiagen) according to the manufa...
Ngày tải lên: 08/03/2014, 09:20