Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf
Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"
... administered intrathecally once daily for 7 days, starting from 1 day before CCI surgery. Evaluation of tactile allodynia and thermal hyperalgesia The paw withdrawal latency (PWL) to radiant heat and ... 5’-CUACCAACAGAGAGGAUAU-3” (siRNA1), 5’-GUCUCAGAUAUCUAGAUCU-3’ (siRNA2), 5’-GAGCCGGAAAGUUAUUGUG-3’ (siRNA3). All siRNAs were chemically synthesized by United Gene Company (Shanghai, China). The ... suppression of TLR4 attenuated CCI-induced mechanical allodynia and thermal hyperalgesia through inhibiting the activation of NF-κB p65 and production of proinflammatory cytokines (e.g., TNF-α and...
- 9
- 487
- 0
Báo cáo Y học: Substrates modulate the rate-determining step for CO binding in cytochrome P450cam (CYP101) A high-pressure stopped-flow study pdf
... structural parameters of the protein and the substratewhich are responsible for the uncoupling process are notwell understood. Data are increasingly accumulated indica-ting that the dynamics of the ... negative activation volumes and slow rebindingkinetics while the substrates norcamphor and adamantane and the substrate-free protein have positive activationvolumes and fast rebinding kinetics. ... 2002between its keto group and the hydroxyl group of the amino-acid residue Tyr-96, and (b) by hydrophobic contacts of its methyl groups C-8, C-9 to Val295 and Asp297 in the b3sheet, and of the methyl...
- 8
- 453
- 0
Báo cáo y học: "Expression of hMSH2 protein of the human DNA mismatch repair system in oral lichen planus"
... primary incubation in the presence of non-immunized rabbit serum instead of the primary antibody. Cell quantification and Statistical analysis The immunolocalization of hMSH2 was quantitatively ... membrane, degeneration of basal keratinocytes, hyperkeratinization and acanthosis [24]. Basal cells are the prime target of destruction in OLP. The mechanism of basal cell damage is related to a ... total number of basal and suprabasal epithelial cells along the six microscopic fields and the number of basal and suprabasal cells stained to hMSH2 protein were assessed. The percentage of...
- 6
- 461
- 0
Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx
... 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢Glu127Ala Sense strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢Anti-sense strand 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢Asp125Ala/Glu127Ala Sense strand ... 5¢-GATGGTATTGATTTTGCCATAGAGCATGGTTCA-3¢Anti-sense strand 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢Asp125Asn Sense strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢Glu127Ala ... 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢Anti-sense strand 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-3¢Tyr183Phe Sense strand 5¢-TATGTATGGGTTCAATTCTTTAACAATCCACCATGCCAG-3¢Anti-sense strand...
- 9
- 616
- 0
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf
... Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation Mikiko Ikeda1, Misato Hinohara1, ... was examined using a Saccharomyces cerevisiae VMA3-deficient strain that lacked its own gene for one of the proteolipid subunits of V-ATPase. Expression of the cDNAs in the strain revealedthat ... (A) subunit of S. cerevisiae V-ATPase was a gift from R. Hirata of the Institute of Physical and ChemicalResearch (Wako, Japan), and the antibody against the 100-kDa (a) subunit of S. cerevisiae...
- 8
- 391
- 0
Báo cáo Y học: Expression and purification of the recombinant subunits of toluene/ o-xylene monooxygenase and reconstitution of the active complex potx
... using a SMART-System (Pharmacia Biotech). The molecular mass markers used as standards for gelfiltration chromatography were b-amylase (200 kDa),aspartate aminotransferase (90 kDa), ribosome inactivatingprotein ... by the programGRAPHPAD PRISM(http://www.graphpad.com).Single turnover assaySingle turnover assays of the individual components(10nmolofTomoH,20nmolofTomoCandTomoDsubunits) and of each of ... check the presence of saturating amounts of NADH over the reactiontime. This was done by running duplicate assays and monitoring the absorbance at 340 nm (the reduced NADHabsorption maximum), and...
- 11
- 478
- 0
Báo cáo Y học: Expression pattern in the antennae of a newly isolated lepidopteran Gq protein a subunit cDNA potx
... cDNArevealed that there is a polyadenylation signal upstream of the poly (A) .Analysis of the primary structure of M. brassicaeGqa The putative protein product encoded by the cloned cDNAwas aligned ... expres-sion localization in the antennae of the first lepidopteran Gprotein a subunit belonging to the Gq family.MATERIALS AND METHODSInsectsAnimals were reared in Domaine du Magneraud (INRA,France) ... wereseparated by SDS/PAGE and analysed by Western-blotusing a Gq/11 a antiserum (Fig. 1). Crude homogenates of male and female antennae contained an immunoreactiveband with an apparent molecular mass of...
- 10
- 619
- 0
Báo cáo Y học: Expression of the aspartate/glutamate mitochondrial carriers aralar1 and citrin during development and in adult rat tissues docx
... We investigated the pattern of expression of aralar1 and citrin in murine embryonic and adult tissues at the mRNA and protein levels. Insituhybridization analysisindicates that both isoforms are ... from the embryos in (A and a) at the axial levels indicated by the dotted lines. Note the strong expression in the limb (B) and tailbuds (arrowhead in A) , in the branchial arches (D) and dermomyotome ... (0.86 and 0.64 standardized values, in atria and ventricles, respectively).(D) Immunoblotting of increasing amounts of recombinant citrin and aralar1. Known amounts (as indicated) of bacterially...
- 8
- 432
- 0
Báo cáo Y học: Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo potx
... microscopy the surfacearea of about 130±170 cells for each animal was measuredby an Image Analyzer KS100 IBAS Kontron ( Karl ZeissJena, Germany), in o rder to calculate the diameter of the adipocytes. ... 3¢,3¢-diaminobenzidinehydrochloride c hromogen (Sigma). The speci®city of the method was tested by the omission of the primary antibody in the staining, and the use of p reimmune serum instead of the ... CCAGCATGCCGAGGGAGTGA NM_009941NRF-1 ATGGGCCAATGTCCGCAGTGATGTC GGTGGCCTCTGATGCTTGCGTCGTCT AF098077b-actin GAACCCTAAGGCCAACCGTGAAAAGAT ACCGCTCGTTGCCAATAGTGATG X03765 a The primers are speci®c for the isoform...
- 10
- 555
- 0
Báo cáo y học: "Expression of Human Globular Adiponectin-Glucagon-Like Peptide-1 Analog Fusion Protein and Its Assay of Glucose-Lowering Effect In Vivo"
... Statistical analysis Data were expressed as means ± standard devi-ations. Data were analyzed using one-way analysis of variance and secondary analysis for significance with the Turkey-Kramer ... [1]. Adiponectin is a protein of 247 amino acids consisting of four domains, an ami-no-terminal signal sequence (1-18 amino acid), a var-iable region (19-41 amino acid), a collagenous domain ... Many attempts have been made to increase its biological half-life and its efficacy in vivo by producing dipeptidyl peptidase IV-resistant GLP-1 analogs via amino acid substitu-tion and hindering...
- 7
- 612
- 0
Từ khóa: Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM