Báo cáo Y học: Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica, involved in biosynthesis of bryonolic acid ppt
... Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica , involved in biosynthesis of bryonolic acid Hiroaki Hayashi 1 , Pengyu Huang 1 , ... 353–729 of G. glabra GgbAS1 b-amyrin synthase [6], was prepared by PCR using GgbAS1 as a template, Taq DNA polymerase (Takara Shuzo, Kyoto, Japan),...
Ngày tải lên: 08/03/2014, 23:20
... (TaKaRa Bio Inc.). Forward primers 5¢-CG TTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CA CAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi- trogen Corporation) and reverse primers 5¢-AAGTAGGCA ACAAAACAACG-3¢ and ... proteins. Plant Mol Biol 38, 77–99. 16 Kamauchi S, Wadahama H, Iwasaki K, Nakamoto Y, Nishizawa K, Ishimoto M, Kawada T & Urade R (2008) Molecular cloning and characterization...
Ngày tải lên: 18/02/2014, 11:20
... as follows. DNA fragments were amplified from cDNAs of GmPDIL-1 and GmPDIL-2 by PCR using the oligonucleotide primers 5¢-GACGACGACAAGATGGAG GAATCATCGGAGAAAGAGTTC-3¢ and 5¢-GAGGAGA AGCCCGGTTCAAAGCTCATCTTTTCCTTTTTC-3¢ ... germi- nation and early growth [18]. Primary soybean seed storage proteins are globulins called glycinin and b-conglycinin. They are folded and assemble into tri-...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica doc
... GTCGTAATTAATCACTTAACCGTGCTCG CYP71 9A2 reverse GAAAGAAACAGAGCAAATCTTATCCTTTTACC CYP71 9A3 forward CCTCGTAACTAATATACCAGTGTGGTG CYP71 9A3 reverse GACAACCAAGCAAACTCTTATTCTTGTAC Internal control gene b-actin ... (5¢-GTTATGGTGTAAGGCATAAAGATTA ACCATAACC-3¢) and 5¢-GSP1 nested (5¢-TGTAAGGCA TAAAGATTAACCATAACCCTAGTACC-3¢) and 3¢- RACE, 3¢-GSP1 (5¢-AATAAGGGTACTAGGGTTATGG TTAATCTTTATGC-3¢) and 3¢...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot
... than six CHH-like cDNA have been identified and can be divided into CHH -A and CHH-B groups [19]. In the crabs Can- cer pagurus, Carcinus maenas and Libinia emarginata and in the crayfishes Procambarus ... RNAs were allowed to anneal by mixing equal amounts of each strand, heating to 100 °C for 1 min, and cooling gradually to room temperature for 3–4 h. Single-stranded RNAs an...
Ngày tải lên: 23/03/2014, 10:20
Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf
... fluorophosphate was from Fluka Chemie AG, Switzerland. Phenylmethanesulfonyl fluoride and okadaic acid were from Sigma. Trypsin of modified sequencing grade was obtained from Promega, and LysC of Achromobacter ... phosphatase and an endosomal protein may be of interest in the light of the recently described histidine phosphorylation of annexin I from a membrane prep...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
... N-terminal sequencing. The amino -acid sequences of proteins X and Y were identified in the Swiss-Prot databank as GatY and UP12, respectively. GatY ( D -tagatose-1,6-bis-phosphate aldolase of class ... including UspA itself (Fig. 2), and one larger protein consisting of two UspA domains in tandem [17]. The small members of this family are proteins of 142–144 amino-acids...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... Ishikara, T. & Fukagawa, Y. (1980) Deacetylation of PS-5, a new beta-lactam compound III. Enzymological char- acterization of L -amino acid acylase and D -amino acid acylase from Pseudomonas ... The N-D-AAase had higher hydrolysing activity against N-ace- tyl- D -amino acid derivates containing D -methionine, D -leucine and D -alanine and against N-chloroacetyl- D -...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo Y học: Purification and characterization of novel kininogens from spotted wolffish and Atlantic cod pdf
... drop- dialysed against water and analysed by MALDI-TOF MS. Phosphatase treatment Dry N-glycan samples were dissolved in 50 m M ammonium bicarbonate, and 1 U of calf intestinal alkaline phosphatase (New ... composed of an N-terminal heavy chain, the bradykinin moiety and a C-terminal light chain. The heavy chain and light chain are interlinked by disulfide bridges. Kininogens...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo khoa học: cDNA cloning and characterization of a novel calmodulinlike protein from pearl oyster Pinctada fucata potx
... between oyster CaM and CaLP. In the presence of calcium, oyster CaLP and CaM appeared as a single band with an apparent molecular weight of approximately 18 kDa and 14 kDa, respectively, whereas in ... second and third EF-hand domains in oyster CaM and CaLP, while it reflected Ca 2+ -binding to the first and second EF-hand domains in the case of VanScyoc et al. CaL...
Ngày tải lên: 16/03/2014, 23:20