Báo cáo khoa học: "Lexical surprisal as a general predictor of reading time" potx
... France, April 23 - 27 2012. c 2012 Association for Computational Linguistics Lexical surprisal as a general predictor of reading time Irene Fernandez Monsalve, Stefan L. Frank and Gabriella ... 20 years of research. Psy- chological Bulletin, 124:372–422. Brian Roark, Asaf Bachrach, Carlos Cardenas, and Christophe Pallier. 2009. Deriving lexical and syn- tactic expectation-bas...
Ngày tải lên: 08/03/2014, 21:20
... spreading activation, the syntactic category aspect of each meaning in turn activates the category's meaning in the grammar space representation. Part of the grammatical meaning of ... (Cf Studies of agrammatic and Broca's aphasia as described in Goodenough, Zurif, and Weintraub, 1977; Goodglass, 1976; Goodglass and Berko, 1960; Goodglass, Gleason, Bernholtz, and...
Ngày tải lên: 08/03/2014, 18:20
... Signal 21, 1626–1633. 84 Kurabayashi N, Hirota T, Sakai M, Sanada K & Fuk- ada Y (2010) DYRK 1A and glycogen synthase kinase 3beta, a dual-kinase mechanism directing proteasomal degradation of ... Nieto MA & Galceran J (2009) Attenuation of Notch signalling by the Down-syndrome-associated kinase DYRK 1A. J Cell Sci 122, 1574–1583. 32 Louvi A & Artavanis-Tsakonas S (2006)...
Ngày tải lên: 22/03/2014, 16:21
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt
... to lm) and stabilize just one protein and thus are gener- ally protein and disease selective, if not specific. Many of the clinically important Fabry disease-asso- ciated a- galactosidase A variants ... 1432–1444. 16 Ishii S, Kase R, Sakuraba H & Suzuki Y (1993) Characterization of a mutant alpha-galactosidase gene-product for the late-onset cardiac form of Fabry disease. Bioche...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx
... recovered differentially based on varying stabilities. Remarkably, we have found that, at least in some circumstances, a quanti- tative correlation to biophysical data can be obtained from a statistical analysis of ... the association of the variable heavy chain (V H )with protein A was used as a surrogate for direct stability measurements. The V H domains in camelid heavy chain...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx
... Actions have a number of param- eters, as well as a precondition and effect, both of which are logical formulas. When a planner tries to apply an action, it will first create an action instance by ... (Fikes and Nils- son, 1971). In this paradigm, a planning state is defined as a finite set of ground atoms of predicate logic that are true in this state; all other atoms ar...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: "Lexical transfer using a vector-space model" doc
... as the word order between the source and target languages) into consideration. These rules usually use case-frames as their base and accompany syntactic and/or semantic constraints on mapping ... from case-frame representations of simple sentences with a thesaurus for generalization (Akiba et. al., 1996 and Tanaka, 1995); (2) approaches using structural matching: to obtain tr...
Ngày tải lên: 20/02/2014, 18:20
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... interclass variance and the smallest intraclass variance, and constructs a linear combination of the variables to discriminate between the classes. The rule i s constructed with training set of samples, and ... with a window of five wavenumbers, assuming that adjacent wavenumbers are highly corr elated. A population o f 3 2 solutions was built at each generation, and e valuated. Th...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx
... in an irreversible covalent attack of a cysteine residue and transfer of a methyl group to the C5 position of the target base [1]. Replacement of C5 by a nitrogen atom in azacytosine (AzaC) facilitates ... temperatures ranging from 15 to 85 °Cwas performed at a constant rate of 0.2 °CÆmin )1 . Absorbance of duplexes at 260 nm was measured using Cary 50 Bio spectrophotomete...
Ngày tải lên: 07/03/2014, 15:20