Báo cáo khoa học: "Lexical surprisal as a general predictor of reading time" potx
Báo cáo khoa học: "Lexical surprisal as a general predictor of reading time" potx
... France, April 23 - 27 2012.
c
2012 Association for Computational Linguistics
Lexical surprisal as a general predictor of reading time
Irene Fernandez Monsalve, Stefan L. Frank and Gabriella ... 20 years of research. Psy-
chological Bulletin, 124:372–422.
Brian Roark, Asaf Bachrach, Carlos Cardenas, and
Christophe Pallier. 2009. Deriving lexical and syn-
tactic expectation-bas...
Báo cáo khoa học: "GAMR VIEWED AS A FUNCTIONING PART OF A COGNITIVES SERM A YTM" pot
... spreading activation,
the syntactic category aspect of each meaning in
turn activates the category's meaning in the
grammar space representation.
Part
of
the grammatical meaning
of ...
(Cf Studies of agrammatic and Broca's aphasia as
described in Goodenough, Zurif, and Weintraub,
1977; Goodglass, 1976; Goodglass and Berko, 1960;
Goodglass, Gleason, Bernholtz, and...
Báo cáo khoa học: MNB⁄ DYRK1A as a multiple regulator of neuronal development pdf
... Signal 21,
1626–1633.
84 Kurabayashi N, Hirota T, Sakai M, Sanada K & Fuk-
ada Y (2010) DYRK 1A and glycogen synthase kinase
3beta, a dual-kinase mechanism directing proteasomal
degradation of ... Nieto MA & Galceran J (2009) Attenuation
of Notch signalling by the Down-syndrome-associated
kinase DYRK 1A. J Cell Sci 122, 1574–1583.
32 Louvi A & Artavanis-Tsakonas S (2006)...
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt
... to
lm) and stabilize just one protein and thus are gener-
ally protein and disease selective, if not specific.
Many of the clinically important Fabry disease-asso-
ciated a- galactosidase A variants ... 1432–1444.
16 Ishii S, Kase R, Sakuraba H & Suzuki Y (1993)
Characterization of a mutant alpha-galactosidase
gene-product for the late-onset cardiac form of Fabry
disease. Bioche...
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx
... recovered
differentially based on varying stabilities. Remarkably, we
have found that, at least in some circumstances, a quanti-
tative correlation to biophysical data can be obtained from
a statistical analysis of ... the association of the variable heavy chain (V
H
)with
protein A was used as a surrogate for direct stability
measurements. The V
H
domains in camelid heavy chain...
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) ... (5¢-TGGTACTCGAG
CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG
AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and
downstream to pyk using primer pyk3 (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4...
Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx
... Actions have a number of param-
eters, as well as a precondition and effect, both of
which are logical formulas. When a planner tries to
apply an action, it will first create an action instance
by ... (Fikes and Nils-
son, 1971). In this paradigm, a planning state is
defined as a finite set of ground atoms of predicate
logic that are true in this state; all other atoms ar...
Tài liệu Báo cáo khoa học: "Lexical transfer using a vector-space model" doc
... as the word order
between the source and target languages) into
consideration. These rules usually use
case-frames as their base and accompany
syntactic and/or semantic constraints on
mapping ... from case-frame
representations of simple sentences with a
thesaurus for generalization (Akiba et. al., 1996
and Tanaka, 1995); (2) approaches using
structural matching: to obtain tr...
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... interclass variance and
the smallest intraclass variance, and constructs a linear
combination of the variables to discriminate between the
classes. The rule i s constructed with training set of samples,
and ... with a window of five
wavenumbers, assuming that adjacent wavenumbers are
highly corr elated. A population o f 3 2 solutions was built at
each generation, and e valuated. Th...
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx
... in an irreversible covalent attack
of a cysteine residue and transfer of a methyl group to the
C5 position of the target base [1]. Replacement of C5 by a
nitrogen atom in azacytosine (AzaC) facilitates ... temperatures ranging from 15 to 85 °Cwas
performed at a constant rate of 0.2 °CÆmin
)1
. Absorbance
of duplexes at 260 nm was measured using Cary 50 Bio
spectrophotomete...