Báo cáo Y học: Proteasome-driven turnover of tryptophan hydroxylase is triggered by phosphorylation in RBL2H3 cells, a serotonin producing mast cell line pptx

Báo cáo Y học: Proteasome-driven turnover of tryptophan hydroxylase is triggered by phosphorylation in RBL2H3 cells, a serotonin producing mast cell line pptx

Báo cáo Y học: Proteasome-driven turnover of tryptophan hydroxylase is triggered by phosphorylation in RBL2H3 cells, a serotonin producing mast cell line pptx

... Proteasome-driven turnover of tryptophan hydroxylase is triggered by phosphorylation in RBL2H3 cells, a serotonin producing mast cell line Yoshiko Iida 1 , Keiko Sawabe 1 , Masayo Kojima 1 , ... Rapid turnover of tryptophan hydroxylase is driven by proteasomes in RBL2H3 cells, a serotonin producing mast cell line. J. Biochem. (...

Ngày tải lên: 08/03/2014, 16:20

9 404 0
Báo cáo khoa học: Autocatalytic processing of procathepsin B is triggered by proenzyme activity doc

Báo cáo khoa học: Autocatalytic processing of procathepsin B is triggered by proenzyme activity doc

... clarified. Procathepsin B was shown by zymography to hydrolyze the synthetic sub- strate 7-N-benzyloxycarbonyl-l-arginyl-l-arginylamide-4-methylcoumarin (Z-Arg-Arg-NH-MEC), suggesting that procathepsin B is ... cathepsins. Results Procathepsin B is active on a small synthetic substrate In a previous study, a low catalytic activity against the substrate 7-N-benzyloxycarbonyl-l-arg...

Ngày tải lên: 07/03/2014, 03:20

9 425 0
Báo cáo y học: " Transcriptome analysis of murine thymocytes reveals age-associated changes in thymic gene expression"

Báo cáo y học: " Transcriptome analysis of murine thymocytes reveals age-associated changes in thymic gene expression"

... 4.53 3.3 TTCATCCGTCACAGG AGTCA AGGAATTCGGAGCAGAGAC A chemokine (C-X-C motif) receptor 6 (Cxcr6) NM_030712 Cxcr6 2.49 7.91 3.98 4.7* AACAGCCAGGAGAA CAAACG GGGCAAGTTCAGCAGAAACA decorin (Dcn) ... the ingenuity data analysis program (www.ingenuity.com) using our uploaded data. ALL CHANGES AT ALL AGES CANONICAL PATHWAYS NUMBER of GENES p VALUE Oxidative Phosphorylation 18 0.001 T...

Ngày tải lên: 03/11/2012, 11:35

14 464 0
Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot

Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot

... the protein in mammalian cells. In order to facilitate the proteins’ purification, a recombinant version was made containing a C-terminal myc tag followed by a His 6 sequence, by cloning the CCR5 ... protein was unidentifiable by autoradiography in cell lysates, but appeared as the predominant band after purification, although a background of contamination by other prot...

Ngày tải lên: 08/03/2014, 09:20

12 541 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

... allophycocyanins and phycocyanins, HPLC separation allowed a quantitative estimation of the relative amount of each protein component from the area underlying each peak. This was facilitated by the fact ... bands having completely disappeared. HPLC analysis of the second sucrose bands of UV-B treated phycobilisome revealed that the b-phycocy- anin peak at 214 nm (indicated with an...

Ngày tải lên: 08/03/2014, 16:20

9 478 0
Báo cáo Y học: Differential regulation of the Fe-hydrogenase during anaerobic adaptation in the green alga Chlamydomonas reinhardtii pot

Báo cáo Y học: Differential regulation of the Fe-hydrogenase during anaerobic adaptation in the green alga Chlamydomonas reinhardtii pot

... reinhardtii Thomas Happe and Annette Kaminski Botanisches Institut der Universita ¨ t Bonn, Germany Chlamydomonas reinhardtii, a unicellular green alga, co n- tains a hydrogenase enzyme, which is induced by ... ORF encoding a protein with an apparent molecular mass of 53.1 kDa. The t ranscription of the hydrogenase gene is very rapidly induced during anaerobic adaptation of...

Ngày tải lên: 08/03/2014, 22:20

11 469 0
 Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"

Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"

... possible NACA 5 Acute vital (life threatening) danger NACA 6 Acute cardiac or respiratory arrest NACA 7 Death Zakariassen et al. Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2010, ... score was in the analyses cate- gorised as NACA 0-1, indicating a patient either with no symptoms/injuries or in no need of medical treat- ment, NACA 2-3, indicating need of m...

Ngày tải lên: 25/10/2012, 09:56

9 785 0
Báo cáo y học: "The epidemiology of intensive care unit-acquired hyponatraemia and hypernatraemia in medical-surgical intensive care unit"

Báo cáo y học: "The epidemiology of intensive care unit-acquired hyponatraemia and hypernatraemia in medical-surgical intensive care unit"

... University of Calgary, Calgary, AB T2N 2T9, Canada 3 Department of Medicine, University of Calgary, Calgary, AB T2N 2T9, Canada 4 Alberta Kidney Disease Network, Calgary, AB T2N 2T9, Canada 5 Calgary ... epidemiology of sodium disturbances in a population of Table 2 Multivariable analyses of patient characteristics* Acquire hyponatraemia Acquire hypernatraemia Characteristic O...

Ngày tải lên: 25/10/2012, 10:31

8 721 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

... Research Paper The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey Adalet Altunsoy 1 , Cenk Aypak 2  , Alpay Azap 1 , ... Department of Family Medicine, Ankara University, School of Medicine, Ibni Sina Hospital 06100, Ankara, Turkey 3. Department of Clinical Microbiology and Infectious Disease, M...

Ngày tải lên: 25/10/2012, 11:00

6 692 0
Báo cáo y học: "Surgical Treatment of Depressed Scar: A Simple Technique"

Báo cáo y học: "Surgical Treatment of Depressed Scar: A Simple Technique"

... General Hospital, Bari, Italy 3. Department of “Head and Neck Diseases”, Hospital “Fatebenefratelli”, Rome, Italy 4. Department of Maxillofacial Surgery, Calabrodental, Crotone, Italy 5. Department ... healing of soft tissues after a trauma. However, ab- normal or disturbed collagen production can cause anomalies of the cutaneous surface and textural ir- regularities. A cosme...

Ngày tải lên: 25/10/2012, 11:00

3 449 0
w