Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

... Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer Lello Zolla, Maria Bianchetti and Sara Rinalducci Dipartimento ... that adaptation of cyanobacterial phycobilisomes to light by complementary chromatic adaptation is a complex process that changes the ratio...

Ngày tải lên: 08/03/2014, 16:20

9 478 0
Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot

Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot

... associated with the cells was analysed by FACS. RESULTS Functional expression of a Myc-his tagged version of CCR5, and a his-tagged version of CD4 Because the post-translational modifications of ... eluted with imidazole. The protein was unidentifiable by autoradiography in cell lysates, but appeared as the predominant band after purification, although a backgroun...

Ngày tải lên: 08/03/2014, 09:20

12 541 0
Báo cáo Y học: Functional analysis of the rat bile salt export pump gene promoter Regulation by bile acids, drugs and endogenous compounds potx

Báo cáo Y học: Functional analysis of the rat bile salt export pump gene promoter Regulation by bile acids, drugs and endogenous compounds potx

... served as a template. An antisense (5¢-CACTGTTTGCTTATATTTCAATGGAA TAAAGTCCAGCTCTAGC-3¢; exchanged bases in bold) and sense (5¢-GCTAGAGCTGGACTTTATTCCATT GAAATA-TAAGCAAACAGTG-3¢) oligonucleotide of the ... membranes. As substrates, such as b-estradiol and rifampin inhibit Bsep promoter activity they are capable of causing cholestasis by the reduction of canalicular bile acid trans...

Ngày tải lên: 17/03/2014, 23:20

9 556 0
Báo cáo Y học: NMR structure of the HIV-1 regulatory protein Vpr in H2O/trifluoroethanol Comparison with the Vpr N-terminal (1–51) and C-terminal (52–96) domains pot

Báo cáo Y học: NMR structure of the HIV-1 regulatory protein Vpr in H2O/trifluoroethanol Comparison with the Vpr N-terminal (1–51) and C-terminal (52–96) domains pot

... a semipreparative Vydac C 18 column using a linear gradient of acetonitrile. An experimental mass of 11 431.92 Da was obtained by electrospray mass spectroscopy and a mass of 11 433.02 Da was calculated ... Tyr50 cH Thr55 2.6H Tyr50 a 1 Gly56 3.5H Tyr50 a 1 Gly56 2.6H Tyr50 a 2 Gly56 3.5H Tyr50 a 2 Gly56 2.6H Tyr50 a Ala59 3.5H Tyr50 a Ala59 2.6H Tyr50 b Ala59...

Ngày tải lên: 31/03/2014, 23:20

10 476 0
Tài liệu Báo cáo Y học: Molecular modeling of the dimeric structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain docx

Tài liệu Báo cáo Y học: Molecular modeling of the dimeric structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain docx

... LPL monoclo- nal antibody against human LPL purified from postheparin plasma. One of the monoclonal antibodies, has an epitope similar to that of the 5D2 monoclonal antibody and was conjugated with ... detected at the same position as the high- affinity peak of wild-type LPL. The LPL in the eluate was detected by Western blot with LPL polyclonal antibody 7640. The fr...

Ngày tải lên: 21/02/2014, 15:20

10 680 0
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

... R105H-fwd:5¢-GCTAAAAATAA TGGAGC ACTCCATTTTTAGCGCTCGC-3¢ . R105H- rev:5¢-GCGAGCGCTAAAAATGGAG TGCTCCATTAT TTTTAGC-3¢. R105K-fwd:5¢-GCTAAAAATAATGGAG AAATCCATTTTTAGCGCTCGC-3¢. R105K-rev:5¢-GCG AGCGCTAAAAATGGA TTTCTCCATTATTTTTAGC-3¢ Sequence ... whereas catalytic activity was altered because the k cat value had decreased dramatic- ally. The structural study showed that the backbone conformat...

Ngày tải lên: 19/02/2014, 02:20

10 504 0
Báo cáo Y học: Functional expression of human liver cytosolic b-glucosidase in Pichia pastoris Insights into its role in the metabolism of dietary glucosides ppt

Báo cáo Y học: Functional expression of human liver cytosolic b-glucosidase in Pichia pastoris Insights into its role in the metabolism of dietary glucosides ppt

... [1,2]. b-Glucosidases h ydrolyse O-glycosidic bonds at the t ermi- nal, nonreducing end of carbohydrates with retention of anomeric con®guration. They are widely present in nature where they demonstrate catalytic ... ietary xenobiotics than f or other aryl-glycosides. These data indicate that human CBG hydrolyses a broad range of dietary glucosides a nd may play a critical rol...

Ngày tải lên: 08/03/2014, 16:20

10 775 0
Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot

Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot

... CATGTTGCTGTAGCAGTTTGAT PO-SR ATATAAGCTTATCCTCTGATAGC AK LF GACCCATCATCGAGGACTA AK SF ACCACAAGGGTTTCAAGCAG AK LR CCACACCAGGAAGGTCTTGT AK SR GGTGGAGGAAACCTTGGACT eIF 4A LF ACGTCAACATGTCCGACAAA eIF 4A SF CGGTGGAGACAACAAGGACT eIF 4A ... TGCTACAGCAACTGGTGATCAGAAGGG LR1 CCCTTCCTGATCACCATGTTGCTGT LR2 GGCCATCATACAGGTGACTAGGAGGGT LR3 GGGTGATTTGACACACGGTTTTGATGGA PWF1 ATGGGATATGTTCTCAGT CHH-SF ACAGA...

Ngày tải lên: 16/03/2014, 06:20

12 474 0
Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf

Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf

... 5¢-TGCAGAGTTCcAtATGGTTGATCAAG-3¢ Antisense 5¢-CGAAAAAAGGAGGAAGAAGCAATGC-3¢ aac2 (A. t.) Sense 5¢-TGTAGAGGTTcAtATGGTTGAACAGACTC-3¢ Antisense 5¢-CTTAATGACTGCGGGATTTGGTGGTAC-3¢ aac3 (A. t.) Sense 5¢-CTGATTTGTACAAcAtATGGATGGATC-3¢ Antisense ... was synthesized enzymatically from [a- 32 P]ATP (NEN, Bad Homburg, Germany), as described by Tjaden et al.[13],andthe purity of the [a- 32 P]ADP p...

Ngày tải lên: 18/03/2014, 01:20

10 486 0
Báo cáo Y học: Kinetic studies of human tyrosyl-DNA phosphodiesterase, an enzyme in the topoisomerase I DNA repair pathway pot

Báo cáo Y học: Kinetic studies of human tyrosyl-DNA phosphodiesterase, an enzyme in the topoisomerase I DNA repair pathway pot

... replication machinery. Accumulation of double- stranded DNA breaks above a threshold, ultimately could cause cell death [2]. Camptothecin, a plant alkaloid originally isolated by Wani & Wall ... DNA with the forward primer, 5¢-GCTGGATCCCTCCCGAGAAACAAATTTCAATG G-3¢, and the reverse primer, 5¢-TCGGGATCCATTTACT AGTCGTTCTCATGACGAGCAAGG-3¢. The amplified DNA fragments were diges...

Ngày tải lên: 31/03/2014, 21:21

8 503 0
Từ khóa:
w