Báo cáo Y học: Overexpression of a recombinant wild-type and

Báo cáo Y học: Overexpression of a recombinant wild-type and His-tagged Bacillus subtilis glycine oxidase in Escherichia coli pptx

... relative efﬁciencies. Analogously, GO and MSOX show a fairly similar activity o n s arcosine and N-ethylglycine. In contrast, an appreciable activity on glycine, glycine- ester a nd D -pipecolic acid was only observed ... SOX catalyses the o xidative demethylati on of sarcosine (N-methylglycine) to form glycine and formalde- hyde. Similarly, DAAO catalyses the oxidative d ea...

Ngày tải lên : 08/03/2014, 16:20

8 482 0

Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

... collected data. Analyses were made by VL, JP, ACF and MC, VL drafted the manuscript, and all authors contributed Lindström et al. Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine ... education, regular evaluation and standardization of protocols in the new EMCC organization. Author details 1 Karolinska Institutet, Department of Clinical Science and Educat...

Ngày tải lên : 25/10/2012, 10:02

5 495 0

Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"

... inten- sity-modulated radiation therapy (IMRT) and the use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain tumors. By the fact that the rare earth ... times are unsatisfactory so far, because radiation induced necrosis [58], vital tumor tissue and cerebral metastases are nearly undistin- guishable.[51] Additionally, p...

Ngày tải lên : 26/10/2012, 09:07

11 655 0

Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

... performed in the US on patient data collected using the US manufactured device and analyzed using the US-based software and New York data analysis center from pa- tients in the US, Germany, and Asia ... deaths annually worldwide and is also an increasing cause of concern in the developing world [2]. In the USA alone the p revalence of CAD is estimated at 5.9% of all...

Ngày tải lên : 03/11/2012, 10:58

13 684 0

Tài liệu Báo cáo Y học: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species doc

... Residues of the catalytic triad are indicated by an asterisk. Secondary structural elements based on known crystal structures of PRK are indicated by h (helix) and s (strand) and calcium binding ligands ... i.e. Cys67–Cys99 and Cys163– Cys194 (numbering of VPR from the N-terminal of the proteinase domain (see Fig. 2 or 3). The proteinase domain of VPR additionally contains Cys...

Ngày tải lên : 21/02/2014, 01:21

11 550 0

Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx

... Technology and Medicine, London SW7 2AZ, UK; 2 Laboratory of Molecular Entomology and Baculovirology, Riken, Wako, Japan Sugar conjugation is a major pathway for the inactivation and excretion of both ... project. A wing disc cDNA library derived from ﬁfth instar B. mori C108 larvae was kindly provided by Dr Kawasaki (University of Utsunomiya, Japan). A total of 1000 clone...

Ngày tải lên : 22/02/2014, 04:20

7 470 0

Báo cáo Y học: Characterization of a low redox potential laccase from the basidiomycete C30 pptx

... [15]. Laccase activity The routine assay for laccase was based on syringaldazine oxidation in 0.1 M phosphate buffer (pH 5.7) at 30 °C. 2,2¢-Azinobis (3-ethylbenzothiazoline-6-sulfonate) (ABTS) and ... enzymes are common in plants, fungi, insects and bacteria [1]. In plants, they may mainly play a role in ligniﬁcation [4] whereas in fungi they probably play the opposite role,...

Ngày tải lên : 08/03/2014, 09:20

7 616 0

Báo cáo y học: "Effects of p-Synephrine alone and in Combination with Selected Bioflavonoids on Resting Metabolism, Blood Pressure, Heart Rate and Self-Reported Mood Changes"

... hesperidin and 600 mg naringin After remaining seated and resting for 45 min., participants completed a second self report rating scale. After 75 min., a third and final self report rating scale ... 2: Advantra Z ® (50 mg of p-synephrine) Group 3: Advantra Z ® with 0 mg hesperidin and 600 mg naringin Group 4: Advantra Z ® with 100 mg hesperidin and 600 mg naringin G...

Ngày tải lên : 25/10/2012, 11:04

7 641 0

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in ﬁssion yeast doc

... GAACCAATGAAATAAGGGCG cyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1 -y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 ... CGTATAAATTACAATACCG Spcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3 -y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAAT...

Ngày tải lên : 18/02/2014, 14:20

16 646 0

Tài liệu Báo cáo Y học: Oxidation of phenols by laccase and laccase-mediator systems doc

... absorbance at 280 nm was plotted against concentration. Oxidations catalysed by laccase and laccase/mediator systems In a typical experiment, 60 lmol of substrates 1–5 were weighedina2-mLscrew-capvialequippedwithastirring bar. ... Oxidation of phenols by laccase and laccase-mediator systems Solubility and steric issues Francesca d’Acunzo, Carlo Galli and Bernardo Masci Diparti...

Ngày tải lên : 21/02/2014, 01:21

6 539 0