Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

Báo cáo y học: "Electronic patient record use during ward rounds: a qualitative study of interaction between medical staff"

Báo cáo y học: "Electronic patient record use during ward rounds: a qualitative study of interaction between medical staff"

... A qualitative study of morning ward rounds of an intensive care unit that triangulates data from video-based interaction analysis, observation, and interviews. Results Our analysis demonstrates ... complex nature of interaction of multidisciplinary communication in an ICU, we have chosen to triangulate three types of qualitative data: video-based interaction analysis, observat...

Ngày tải lên: 25/10/2012, 10:31

8 503 0
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

... (5¢)3¢) C7 3A AAATGAGCCCAACAAAG CCGAGAAAAACATT I9 7A- R9 8A AATTTGATGCTCGACAGGCT GCCGCGGAGACATGG W10 1A CAATCCGGGAGACA GCTGGTGATGAAAA F11 6A- L11 7A- L11 8A- G11 9A TAGCCACACTTG CAGCCGCGGCCAAAAATG W16 2A TTAATGGGGATGAGAGCGGTT GCCACTTTCT C16 7A ... AGCAACTATCCACCGTTC GCTTCAGGGACTG E26 4A TGCTTCATCTTG CTGACGTGTACGTGGGACT C27 1A ATGTGTACGTGGGACTGGCACTTCGAAAGC C29 5A AAAATGGCCTACAGTTTA G...

Ngày tải lên: 08/03/2014, 16:20

7 404 0
Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"

Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"

... (Agilent, Santa Clara, CA). Total RNA (5 µg) were used for preparing biotinylated cRNA using GeneChip IVT Labeling Kit (Affymetrix, Santa Clara, CA). After confirmation of the quality of labeled ... forward, 5’-CCTGTACCCGTATTGCGACT-3’; ITGB4 reverse 5’-AGGCCATAGCAGACCTCGTA-3’; COBRA1 for- ward 5’-TGAAGGAGACCCTGACCAAC-3’; COBRA1 reverse 5’-ATCGAATACCGACTGGTGGA-3’; ANK3 forward 5’-GG...

Ngày tải lên: 31/10/2012, 15:28

8 704 0
Tài liệu Báo cáo Y học: Functional analysis of DM64, an antimyotoxic protein with immunoglobulin-like structure from Didelphis marsupialis serum pdf

Tài liệu Báo cáo Y học: Functional analysis of DM64, an antimyotoxic protein with immunoglobulin-like structure from Didelphis marsupialis serum pdf

... (M13F-cccagtcacgacgttg taaaacg- and M13R-agcggataacaatttcacacagg) were from Life Technologies, Inc. All other chemicals were of analy- tical grade or higher quality. Animals, venoms, and toxins D. marsupialis ... kDa), carbonic anhydrase (30 kDa), soybean trypsin inhibitor (20.1 kDa) and a- lactalbumin (14.4 kDa). Molecular mass DM64 molecular mass was determined by MALDI-TOF MS on a Voy...

Ngày tải lên: 21/02/2014, 01:21

11 621 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

... franciscana Oligomerization and thermotolerance Julie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRae Department of Biology, Dalhousie University, Halifax, Nova Scotia, Canada Oviparously ... cysts [57], and molecular mass markers o f 29 kDa (carbonic anhydrase), 66 k Da (bovine serum albumin), 150 kDa (alcohol dehydrogenase), 200 kDa (a- amylase), 443 kDa (apoferritin), and 669 kDa .....

Ngày tải lên: 22/02/2014, 04:20

10 495 0
Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot

Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot

... receptors CCR5 and CD4 in liposomes Franc¸ois Devesa, Vida Chams, Premkumar Dinadayala, Alexandre Stella, Aude Ragas, Henri Auboiroux, Toon Stegmann and Yannick Poquet Institut de Pharmacologie et ... the protein in mammalian cells. In order to facilitate the proteins’ purification, a recombinant version was made containing a C-terminal myc tag followed by a His 6 sequence, by clon...

Ngày tải lên: 08/03/2014, 09:20

12 541 0
Báo cáo Y học: Functional expression of human liver cytosolic b-glucosidase in Pichia pastoris Insights into its role in the metabolism of dietary glucosides ppt

Báo cáo Y học: Functional expression of human liver cytosolic b-glucosidase in Pichia pastoris Insights into its role in the metabolism of dietary glucosides ppt

... a- L -arabinopyranoside, b- L -arabinopyranoside, a- L -arabino-furanoside, a- D -man- nopyranoside, a- D -mannopyranoside, a- D -fucopyranoside, a- D -xylopyranoside, a- L -rhamnopyranoside) w as deter- mined u sing the ... ietary xenobiotics than f or other aryl-glycosides. These data indicate that human CBG hydrolyses a broad range of dietary glucosides a nd may play a...

Ngày tải lên: 08/03/2014, 16:20

10 775 0
Báo cáo Y học: Functional epitope of common c chain for interleukin-4 binding ppt

Báo cáo Y học: Functional epitope of common c chain for interleukin-4 binding ppt

... interface, but do not play a key role in binding. The loss of binding affinity of the four variants I10 0A, L10 2A, Y1 0 3A a nd L20 8A i s not likely to be c aused by extended structural alterations, a ... [6]), indicating that c c binding contributes only m arginally to IL-4 binding affinity with the whole receptor complex (see also [21]). Remarkably, only a l owering of t he...

Ngày tải lên: 08/03/2014, 16:20

10 447 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

... that adaptation of cyanobacterial phycobilisomes to light by complementary chromatic adaptation is a complex process that changes the ratio of phycocyanin to phycoerythrin in rods of certain ... allophycocyanins and phycocyanins, HPLC separation allowed a quantitative estimation of the relative amount of each protein component from the area underlying each peak. This was facil...

Ngày tải lên: 08/03/2014, 16:20

9 478 0
 Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

... were admitted to Stavanger University Hospital. We defined severe trauma as a primary diagnosis of traumatic injury and a National Committee on Aeronautics severity of injury or illness index (NACA) ... Another recent study also indicated that delaying ALS in critically injured patients until arrival in the trauma centre worsens outcome [21]. One remaining question in this st...

Ngày tải lên: 25/10/2012, 09:56

6 612 0
w