Báo cáo Y học: A catalytically inactive b1,4-N-acetylglucosaminyltransferase III (GnT-III) behaves as a dominant negative GnT-III inhibitor potx

Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

... increasing passenger load. Additionally, the average passenger age is also steadily rising because of increased life expectancy in western countries. It has been estimated that by the year 2030, ... (temperature, humidity or air pressure), and other additional factors associated with travel, such as the stress of increased security, decreased seat space and increasing delays, can also trigg...

Ngày tải lên: 25/10/2012, 10:31

6 640 0
Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"

Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"

... whereas the yield is nearly quantitative and the product can be purified easily by recrystallization (scheme/table 4). Further ring sys- tems, dedicated for chemical reactions as described above, ... catalytically accelerated reaction variant introduced by Sharpless, only few hours at room temperature are required [5] as shown with a plenty of reaction examples. [6-14] A secon...

Ngày tải lên: 26/10/2012, 09:39

10 623 0
 Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"

Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"

... Germany using the ABI PRISM Big Dye Terminator system (Applied Biosystems, Germany). Sequences were analyzed using the Chromas software (Technely- sium Pty Ltd, Tewantin, Australia) and GeneDoc ... cellular pathways leading to chromosomal instability [12]. As the disruption of the above described cellular oncogenic pathways also plays an important role in hematological malignancies we...

Ngày tải lên: 31/10/2012, 16:49

4 393 0
Tài liệu Báo cáo Y học: Dissecting the effect of trifluoroethanol on ribonuclease A Subtle structural changes detected by nonspecific proteases ppt

Tài liệu Báo cáo Y học: Dissecting the effect of trifluoroethanol on ribonuclease A Subtle structural changes detected by nonspecific proteases ppt

... three independent measurements ± SD. Proteinase K activity assay Proteinase K activity was determined at 25 °Cwith N-succinyl-Ala-Ala-Ala-p-nitroanilide as substrate [26]. Assay mixtures were composed ... unfolding; proteolysis: spectroscopy. The application of organic solvents in enzymatically cata- lyzed reactions has gained increasing importance [1,2]. Unfortunately, most of these solven...

Ngày tải lên: 22/02/2014, 07:20

7 492 0
Báo cáo Y học: Recombinant human glucose-6-phosphate dehydrogenase Evidence for a rapid-equilibrium random-order mechanism potx

Báo cáo Y học: Recombinant human glucose-6-phosphate dehydrogenase Evidence for a rapid-equilibrium random-order mechanism potx

... Accordingly, numerous Glc6P dehydrog- enase mutations are associated with haemolytic anaemia [5]. Until recently, detailed structural information was avail- able only for the Glc6P dehydrogenase of ... An appropriate amount of enzyme, typically in 10 lL, was added to initiate reaction. Enzyme activity was assayed at 25 °Cwitha recording F-4500 spectrofluorimeter (Hitachi). The excita- tion and...

Ngày tải lên: 08/03/2014, 22:20

8 373 1
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... e11235. 53 Verma A, Halder K, Halder R, Yadav VK, Rawal P, Thakur RK, Mohd F, Sharman A & Chowdhury S (2008) Genome-wide computational and expression analyses reveal G-quadruplex DNA motifs as conserved cis-regulatory ... sarcoma protein as a G-quadruplex DNA- and RNA-binding protein Kentaro Takahama 1, *, Katsuhito Kino 2, *, Shigeki Arai 3 , Riki Kurokawa 3 and Takanori Oyoshi...

Ngày tải lên: 15/02/2014, 01:20

11 787 0
Tài liệu Báo cáo Y học: Transactivation domains are not functionally conserved between vertebrate and invertebrate serum response factors potx

Tài liệu Báo cáo Y học: Transactivation domains are not functionally conserved between vertebrate and invertebrate serum response factors potx

... 2002 TCTTATATGAATGCAGTTCTG-3¢;N3:5¢-GGGAAT TCGCTAGGCCACAGTTTGAATTTG-3¢;N4:5¢-GGG AATTCGACCTCTGAAAATGTAAAACAG-3¢;N5: 5¢-GGGAATTCGGATCCTCTAACTGGGTTAGAT-3¢; N6: 5¢-GGGAATTCGTCCCCGGACGAGGACAGG TCA-3¢;N7:5¢-GGGAATTCGCCTGCCAATGGTAAA AAGACA-3¢. TheC1deletionwasgeneratedbyPCRusingthe oligonucleotide ... growth-factor transduction pathways, such as the classical ternary complex factors, that are act...

Ngày tải lên: 22/02/2014, 07:20

9 393 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... hnRNP A1 C UAGACUAGA 5428–5437 ESE2 SC35, SRp40 CCAGUAGAUCCUAGACUAGA 5418–5437 A5 ESE GAR ASF ⁄ SF2, SRp40 GAAGAAGCGGAGACAGCGACGAAGA 5558–5582 [7] A7 ESS3 hnRNP A1 , hnRNP E1 ⁄ E2 AGAUCCAUUCGAUUAG unknown 8047–8062 ... 32] ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950 ESE3 ASF ⁄ SF2 GAAGAAGAA 8016–8025 hnRNP A1 UAGAAGAAGAA 8018–8025 HIV-1 alternative splicing regulation J. Tazi et al....

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx

Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx

... for Parallel Processing, Bulgarian Academy of Sciences, nakov@lml.bas.bg are taking the GRE test nowadays are familiar with an instance of this problem – verbal analogy ques- tions, which ask ... product, source, stative, whole) and QUALITY (container, content, equa- tive, material, measure, topic, type). For example, exam anxiety is classified as effect and therefore as CAUSALITY, and blu...

Ngày tải lên: 08/03/2014, 01:20

9 390 0
Báo cáo Y học: Identification of the 19S regulatory particle subunits from the rice 26S proteasome potx

Báo cáo Y học: Identification of the 19S regulatory particle subunits from the rice 26S proteasome potx

... human i mmunodeficiency vir us-1 Tat bin ding protein and subunit 4 of human 26S protease (proteasome). Plant Sci. 103, 33–40. 20. Yanagawa ,Y. ,Ueda,T.,Yamamoto,K.,Sasaki,T.,Tanaka,K., Hashimoto, ... proteaso me in rice (Oryza sativa L.). FEBS Lett. 403, 313–317. 32. Kimura, Y. , Takaoka, M ., Tanaka, S., Sassa, H., Tanaka, K., Polevoda, B., Sherman, F . & Hirano, H. (2000) N (alpha)- ac...

Ngày tải lên: 08/03/2014, 16:20

10 495 0
w