Management of patients with dementia: A national clinical guideline docx
... 4 PHARMACOLOGICAL INTERVENTIONS Management of patients with dementia A national clinical guideline 1 Introduction 1 2 Diagnosis 3 3 Non-pharmacological interventions 7 4 Pharmacological interventions ... disease and people with mixed dementias. B Galantamine, at daily doses of 16mg and above, can be used for the management of associated symptoms in peop...
Ngày tải lên: 08/03/2014, 14:20
... less cardiac adverse effects. 5 SYSTEMIC THERAPY Management of breast cancer in women A national clinical guideline 1 Introduction 1 2 Diagnosis, referral and investigation 2 3 Surgery 7 4 Radiotherapy ... ...
Ngày tải lên: 08/03/2014, 14:20
... means they are the group least able to take advantage of the benefits of work and their capacity to realize the goals of the ADA and IDEA are severely limited because of their lack of employment. ... including Australia and Canada (Organization for Economic Cooperation and Development, 2009). In America today, being a person with a disability greatly increases the likeli...
Ngày tải lên: 14/02/2014, 09:20
Báo cáo y học: "Special considerations in the treatment of patients with bipolar disorder and medical co-morbidities"
... complications when taken with antiplatelet agents, warfarin or niacin. Carbamazepine acts as an inducer of cytochrome 3A4 , which may increase the metabolism of some anticoagulant and cardiovascular medications. ... Khojainova N, Santiago-Palma J, Kornick C, Breitbart W, Gonzales GR: Olanzapine in the management of cancer pain. J Pain Symptom Manage 2002, 23:346-350. Annals of Gen...
Ngày tải lên: 25/10/2012, 10:51
Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"
... indication. Our findings revealed that better equivalence exists in urban than in rural areas, and for cancers with a high death rate than for ‘rare’ cancers. The possible expla- nations may ... death certificate. Third, social class, which is also associated with both smok- ing and cancer deaths, was not measured in this study, and the separate calculation of risk patterns in u...
Ngày tải lên: 26/10/2012, 09:48
Guidelines for the Nutritional Management of Children With Renal Disease pot
... Steroid therapy and adequate renal function lead to a renewed appetite and often excessive weight gain. Transplanted children are also at greater risk of developing coronary heart disease in later ... Expressed breast milk can be fortified with energy and may be mixed with another formula if insufficient amounts are available. Farley's First has the lowest potassium and pho...
Ngày tải lên: 05/03/2014, 12:20
TYPE 2 DIABETES - National clinical guideline for management in primary and secondary care (update) pdf
... disease (heart attacks, angina), peripheral artery disease (leg claudication, gangrene), and carotid artery disease (strokes, dementia). Many people with Type 2 diabetes have the same risk of a ... the background population. Accordingly management of cardiovascular risk factors plays a large part in care of people with Type 2 diabetes, and is particularly cost effective. Beca...
Ngày tải lên: 08/03/2014, 14:20
Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx
... (5¢fi3¢) Corresponding peptide AS1 GGTTGCCTGAGRTGYATHTG a GCLRCIC AS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATL AS3R GAGTGTAGCGTCTGACCAATAGCC GYWSDATL AS4R GATCTGATACGGTCCACACGACAG LSCGPYQI a H ¼ A or C or T; R ¼ AorG;Y¼ ... 12 0A PTH analyser. Synthesis of cDNA Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. It was treated with RNAa...
Ngày tải lên: 19/02/2014, 12:20