Báo cáo khoa học: Characterization of isocitrate dehydrogenase from the green sulfur bacterium Chlorobium limicola A carbon dioxide-fixing enzyme in the reductive tricarboxylic acid cycle ppt

Báo cáo khoa học: Characterization of isocitrate dehydrogenase from the green sulfur bacterium Chlorobium limicola A carbon dioxide-fixing enzyme in the reductive tricarboxylic acid cycle ppt

Báo cáo khoa học: Characterization of isocitrate dehydrogenase from the green sulfur bacterium Chlorobium limicola A carbon dioxide-fixing enzyme in the reductive tricarboxylic acid cycle ppt

... 5¢ -A AAAA CATATGGCAAGCA AATCGACCATCATCTACAC-3¢, and antisense, 5¢-AAA AA GGATCCCGGCTGAAAACCGGGCTGCATTA-3¢) were designed for amplification of idh flanked with NdeI and BamHI sites (underlined). After ... Characterization of isocitrate dehydrogenase from the green sulfur bacterium Chlorobium limicola A carbon dioxide-fixing enzyme in the reductive tricarbo...

Ngày tải lên: 08/03/2014, 10:20

6 481 0
Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

... lipids in cells from human adenocarcinomas Anna Maria Luciani 1 , Sveva Grande 1 , Alessandra Palma 1 , Antonella Rosi 1 , Claudio Giovannini 2 , Orazio Sapora 3 , Vincenza Viti 1 and Laura Guidoni 1 1 ... p.p.m., attributed to arachidonic acid chains, and at 0.93–2.04 p.p.m., attributed to linolenic acid chains on the basis of a comparison with lipid extracts and from the d...

Ngày tải lên: 18/02/2014, 13:20

14 765 0
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

... on similarities in amino acid sequences, groups together chitinases and proteins devoid of catalytic activity due to the substitution of a critical amino acid in the cata- lytic centre. This latter ... (5¢-CTTCCTCCGCTTCCATGA-3¢) and QaCgClp1 (5¢-CCATGAAGTCCGCGAATC-3¢); and QsCgClp2 (5¢-GCATAGCGATGTGGACGA-3¢) and QaCgClp2 (5¢-GAGGACCGAGACCGTGAA-3¢). The abbreviations ‘Qs’ a...

Ngày tải lên: 19/02/2014, 00:20

9 584 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

... vertebrate DNASE1 expression in vivo or in vitro, including characterization of the promoter region of the gene and the associated transcriptional factors. Therefore, delineation of the transcriptional regulation ... determine the relative abundance by comparing the copy number of transcripts containing exon 1a with the number starting from exon 1. The abun- d...

Ngày tải lên: 19/02/2014, 06:20

12 610 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... primers: gatggatcccatATGGGTG TTGAAGTTGTA annealing around the start codon of the Ppi1 ORF and gactcgagATTAGTCGACTTCTTACGC annealing just before the putative transmembrane domain (capital letter in the ... Characterization of the interaction between the plasma membrane H + -ATPase of Arabidopsis thaliana and a novel interactor (PPI1) Corrado Viotti, Laura Luoni, Piero M...

Ngày tải lên: 19/02/2014, 07:20

8 629 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... domain in blue and the C-terminal domains in violet. The assumed start of the second C-terminal domain is indicated with a black arrow. A. N. Larsen et al. Characterization of a Serratia proteinase ... the enzymatic activities originating from these strains (unpublished data). One of the marine bacteria showing peptidase activ- ity was closely related to Serratia...

Ngày tải lên: 19/02/2014, 07:20

14 524 0
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

... 5¢-TAT GGATCCTTAATTAGAAACAAACTGTCTGA TAAAC P2OH 5¢- CTCGAGATTAGAAACAAACTGTCTGATAAACC P1Z 5¢-ATA CCATGGCTGGAGAAGACTTTAAGATC P1ZH 5¢- CATATGACTGGAGACTTTAAGATC P2Z 5¢-TAT GGATCCTCACCACCCAATTTCGGAAAG P2ZH 5¢- CTCGAGCCACCCAATTTCGGAAAGT Table ... and His-tag, respectively. Underlined are the restriction enzyme sites. Primer Sequence P1O 5¢-ATA CCATGGACAAAACCCACAGTACAATG P1OH 5¢- CATATGCACAAAACC...

Ngày tải lên: 19/02/2014, 12:20

8 650 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Grazia U, Felli MP, Vacca A, Farina AR, Maroder M, Cappabianca L, Meco D, Farina M, Screpanti I, Frati L et al. (1994) Positive and negative regulation of the com- posite octamer motif of the interleukin ... (Primer Kin188; 5¢-dGAGA GGTACCGAATTAATCACAAGCAA ATCTTCTC-3¢, corresponding to NTs )119 to )94). (7) Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab. (Primer Kin160; 5¢-dGAGA GGTACCGC...

Ngày tải lên: 19/02/2014, 16:20

18 509 0
Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

... by a large vacuole containing anthocyanins. On the other hand, carnation petals have already provided a suit- able material for studying alterations of membrane structure and activity associated ... evolutionary pressures acting in the plant and the animal kingdoms. The liver carrier has presumably evolved to facilitate the uptake of the low concentrations of anthocyan...

Ngày tải lên: 20/02/2014, 01:20

15 589 0
Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx

Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx

... differences in binding of ICAM-4 and the other two ICAMs for the I domains. Many of these mAbs displayed similar inhibitory profiles in assays investigating the effects of the mAbs on the interaction of ... to localize the ligand binding sites in the leukocyte b 2 integrins. The a chains of the CD11/CD18 integrins contain an inserted approxi- mately 200-amin...

Ngày tải lên: 20/02/2014, 11:20

14 495 0
w