Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starﬁsh embryogenesis ppt

... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG 2459 AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC 2519 TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG 2639 TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT 2699 TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC ... CCGCAGCTCAGTGGTGTCAAGGCCCATGTCACACTCAATGTCAAGAGTGCTTAATTTGCT 2279 P Q L S G V K A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT 2339 GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT 2399 ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG...

Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus inﬂuenzae pot

... (phosphoethanolamine), 123.05; PCho (phosphocholine), 165.13 and lipid A- OH (O-deacylated lipid A) , 953.02. Relativeabundance was estimated from the area of molecular ion peak relative to the total area (expressed ... strain, this remains to be deter-mined. Genetic analysis has also shown that the lpsA genemay be nonfunctional, which is consistent with the lack of OS extension at HepIII (M. Deadman, personal ... ﬁltration chromatography and GLC were carried out asdescribed previously [16].Preparation of OS materialO-Deacylation of LPS. O-Deacylation of LPS wasachieved with anhydrous hydrazine, as described...

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding speciﬁcity and target candidates doc

... functionugcgucugacaUGUACAGCcccugccaaauuuuaauaggcaatAGUAAAUAaauaacgacaagaagcaaauggAt5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040 ... and5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAACTTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATGCAGAAATTCAGTAGCAACATGGTGGAACGATGTCTCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCACCATGTTGCTACTGAATTTCTGCA-3¢ (reverse) ... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040 (1) Protein containing DNAJ domain;unknown functioncuacgucggacggaacugggaaaccgaucaguguugguagugaguuaacucggugaccgaguuaguagaacgaguuaauuagUGUAAAUAcgaagccaAt4g39090 (1)...

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... absorption bands. Heme catabolism byHOs of mammals, pathogenic bacteria, cyanobacteriaand probably insects is considered to have a similarmechanism, because the characteristic absorptionbands of verdoheme ... degradation rate of GmHO-1, indi-cated in Table 4, is comparable to that of SynHO-1 inthe presence of NADPH, FNR, and Fd, and also to that of rHO-1 in the presence of NADPH and CPR.Here, NADPH ... T, Zhang X, Sun D,Sato M, Sasahara M, Kayama T, Ikeda-Saito M &Yoshida T (2000) Histidine 20, the crucial proximalaxial heme ligand of bacterial heme oxygenase Hmu Ofrom Corynebacterium...

Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt

... mutagenesis.Roles of Asn266Superimposition of Hyb-24DNY with the class A b-lactamase revealed that Asn266 of Hyb-24DNY has a similar spatial position to that of Glu166 in theclass A b-lactamase ... potentially possesses an advantage for biotechnological applications.X-ray crystallographic analyses of the G181D ⁄ H266N ⁄ D370Y enzyme andthe inactive S11 2A- mutant–Ald complex revealed that Ald ... Higuchi2,3, Yoshiaki Wakitani1,Yusuke Matsuura1, Yusuke Nakata1, Masahiro Takeo1, Dai-ichiro Kato1and Seiji Negoro11 Department of Materials Science and Chemistry, Graduate School of Engineering,...

Báo cáo khoa học: Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae pot

... late endosomal ⁄ prevacuolar structures. At 10 min,punctate staining diminished and vacuolar staining in-creased, and ﬁnally punctate staining was almost lostwith predominant vacuolar staining ... 4 kinase [15]. Lastly, it appears that OSBP and its homologs may also participate inother cellular activities such as cell cycle [16], meiosisand mating [17], mitosis and tumor metastasis [18].The ... Guimaraes da Costa F, Paschoal ME,Ronco LV, Carvalho MG & Pardee AB (1999) Identiﬁ-cation of a gene encoding a human oxysterol-bindingprotein-homolog: a potential general molecular markerfor...

Báo cáo khoa học: Molecular characterization of H2O2-forming NADH oxidases from Archaeoglobus fulgidus potx

... (5¢-CGCGCCATGGCCAAGCTTTTCGAGCCAATCGAG-3¢, sense) and BG855(5¢-CGCGGGATCCCTAAACCTTCAAAGCCAGAT-3¢,antisense), with restriction sites NcoIandBamHI in bold;for noxC primer BG831 (5¢-GCGCGTCATGATGGAATGCCTTGACTTGCTGTTC-3¢,sense)andBG832(5¢-CGCGCGGATCCTCACCATTTTTCGAAGTGCGTGAG-3¢,antisense), ... instead of FAD, or NADPH instead of NADH no NoxC activity was found For this reason,further puriﬁcation and characterization of NoxC wasabandoned.Puriﬁcation of the recombinant enzymesNoxA-1 and ... Michaelis–Menten equation.It was assumed that the NADH concentration wassaturating, meaning that only apparent Kmvalues wereobtained.Ó FEBS 2003 H2O2-forming NADH oxidases from Archaeoglobus...

Tài liệu Báo cáo khoa học: Identiﬁcation of a novel matrix protein contained in a protein aggregate associated with collagen in ﬁsh otoliths pdf

... structure–functionrelationship analysis of Prismalin–14 from the prismaticlayer of the Japanese pearl oyster, Pinctada fucata.FEBS J 274, 5158–5166.9 Murayama E, Takagi Y, Ohira T, Davis JG, GreeneMI & Nagasawa ... byinvertebrates, and has three crystal phases: calcite, ara-gonite and vaterite. Although calcite is the most stablecrystal thermodynamically, many organisms can formmetastable aragonite crystals ... M, Hasegawa K, HoritaC & Akera S (1999) A new matrix protein familyrelated to the nacreous layer formation of Pinctadafucata. FEBS Lett 462, 225–229.5 Kono M, Hayashi N & Samata T...

Báo cáo khoa học: Identiﬁcation of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

... clinicalisolates that were not reactive with these mAbs. Structuralanalysis of meningococcal clinical isolates revealed anadditional and uniquely located glucose residue in the coreoligosaccharide ... againobserved; this is due to a difference in the phosphory-lation pattern of the lipid A region (unpublished data).MS analysis indicated that there was no PEtn in the coreoligosaccharide, and this was ... glycoformswere also observed for strains 425/93 and 1000 (Table 1).Core oligosaccharide from the 1000 galE mutant strainwas also prepared and examined by MS. A range of molecular masses was...

Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

... sequence of the coding region: 5¢TTACAAGGACAAATTAATTGTGCCAG. For ampliﬁcation of the long isoform the same 5¢ primers were used, the 3¢speciﬁc primer was FF3B: 5¢TTACAAGTCTTGCAAAGGGAAGGAT. For ampliﬁcation ... 1337 Molecular characterization and allergenic activity of Lyc e 2(b-fructofuranosidase), a glycosylated allergen of tomatoSandra Westphal1, Daniel Kolarich2, Kay Foetisch1, Iris Lauer1, ... M.E., Ariano, R., Di Felice, G. & Pini, C. (2001) Rapidisolation, characterization, and glycan analysis of Cup a 1, themajor allergen of Arizona cypress (Cupressus arizonica) pollen.Allergy...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX BT Tieng anh 6 UNIT 2 Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ