Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt
Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt
... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG 2459 AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC 2519 TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG 2639 TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT 2699 TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC ....
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot
... (phosphoethanolamine), 123.05; PCho (phosphocholine), 165.13 and lipid A- OH (O-deacylated lipid A) , 953.02. Relative abundance was estimated from the area of molecular ion peak relative to the total area (expressed ... strain, this remains to be deter- mined. Genetic analysis has also shown that the lpsA gene may be nonfunctional, which is consistent with the lack of OS extensi...
Ngày tải lên: 08/03/2014, 02:21
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc
... function ugcgucugaca UGUACAGCcccugccaaauuuuaauaggcaat AGUAAAUAaauaacgacaagaagcaaaugg At5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 ... and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCATGAGACAT...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... absorption bands. Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of verdoheme ... degradation rate of GmHO-1, indi- cated in Table 4, is comparable to that of SynHO-1 in the presence of NADPH, FNR, and Fd, and also to that of rHO-1 in the pre...
Ngày tải lên: 19/02/2014, 05:20
Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt
... mutagenesis. Roles of Asn266 Superimposition of Hyb-24DNY with the class A b-lactamase revealed that Asn266 of Hyb-24DNY has a similar spatial position to that of Glu166 in the class A b-lactamase ... potentially possesses an advantage for biotechnological applications. X-ray crystallographic analyses of the G181D ⁄ H266N ⁄ D370Y enzyme and the inactive S11 2A- mutant–Ald...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae pot
... late endosomal ⁄ prevacuolar structures. At 10 min, punctate staining diminished and vacuolar staining in- creased, and finally punctate staining was almost lost with predominant vacuolar staining ... 4 kinase [15]. Lastly, it appears that OSBP and its homologs may also participate in other cellular activities such as cell cycle [16], meiosis and mating [17], mitosis and tumor metastasis [18...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Molecular characterization of H2O2-forming NADH oxidases from Archaeoglobus fulgidus potx
... (5¢-CGCGCCATGGCCAAG CTTTTCGAGCCAATCGAG-3¢, sense) and BG855 (5¢-CGCGGGATCCCTAAACCTTCAAAGCCAGAT-3¢, antisense), with restriction sites NcoIandBamHI in bold; for noxC primer BG831 (5¢-GCGCGTCATGATGGAAT GCCTTGACTTGCTGTTC-3¢,sense)andBG832(5¢-CG CGCGGATCCTCACCATTTTTCGAAGTGCGTGAG-3¢, antisense), ... instead of FAD, or NADPH instead of NADH no NoxC activity was found For this reason, further pu...
Ngày tải lên: 08/03/2014, 02:21
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... structure–function relationship analysis of Prismalin–14 from the prismatic layer of the Japanese pearl oyster, Pinctada fucata. FEBS J 274, 5158–5166. 9 Murayama E, Takagi Y, Ohira T, Davis JG, Greene MI & Nagasawa ... by invertebrates, and has three crystal phases: calcite, ara- gonite and vaterite. Although calcite is the most stable crystal thermodynamically, many organisms can...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx
... clinical isolates that were not reactive with these mAbs. Structural analysis of meningococcal clinical isolates revealed an additional and uniquely located glucose residue in the core oligosaccharide ... again observed; this is due to a difference in the phosphory- lation pattern of the lipid A region (unpublished data). MS analysis indicated that there was no PEtn in the core...
Ngày tải lên: 08/03/2014, 02:20
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf
... sequence of the coding region: 5¢TTAC AAGGACAAATTAATTGTGCCAG. For amplification of the long isoform the same 5¢ primers were used, the 3¢ specific primer was FF3B: 5¢TTACAAGTCTTGCAA AGGGAAGGAT. For amplification ... 1337 Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato Sandra Westphal 1 , Daniel Kolarich 2 , Kay...
Ngày tải lên: 21/02/2014, 00:20