Báo cáo Y học: Defective translocation of a signal sequence mutant in a prlA4 suppressor strain of Escherichia coli doc
... kinetics of wild-type and mutant PhoE in prlA4 mutant strain CE1512, using processing as a criterion for translocation. The prlA4 phenotype of the strain was confirmed by studying the processing kinetics ... from Pierce. Bacterial strains and plasmids The E. coli strains and plasmids used in this study are listed in Table 1. To obtain a prlA4 derivative of str...
Ngày tải lên: 08/03/2014, 09:20
... ACCCGG GTCG ACTCAGTGATGGTGGTGATGGTGTCCTCGACC AAAAAGATC; rcpA:forward,GCGATA GAATTCATG AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; cphB:forward,GCGATA GAATTC ATG ACGAATTGCGATCGCGA ... phytochrome-like proteins of cyanobacteria (Calothrix sp. CphA and -B, Synechocystis sp. Cph1, and Anabaena sp. AphA and AphB, GenBank numbers AB028873 and AB034952),...
Ngày tải lên: 08/03/2014, 23:20
... Airways, Brussels, Bulgaria Air, Condor, Croatia Airlines, Cyprus Airways, Czech Airlines, Eurowings, Finnair, Germanwings, Ibe- ria, Icelandair, JAT Airways, KLM, LOT, Lufthansa, Malev, Olympic, ... surgical department of an aca- demic teaching hospital (Department of General and Visceral Surgery, Augusta Krankenanstalt, Academic Teaching Hospi- tal of the Ruhr-University Bochum). A...
Ngày tải lên: 25/10/2012, 10:31
Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"
... [37-39] Using tetrazine derivative A (diene), the pri- mary adduct of the DAR inv , stabilizes C and D by eliminating nitrogen under formation of colorless dihydropyridazine derivatives and a reverse ... As generally known, the impetus of the Staud- inger-Ligation originates from the dissociation of the nitrogen from the primary adduct of phosphine and azide. Insofar a...
Ngày tải lên: 26/10/2012, 09:39
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... original volume of the nuclear extract by trichloroacetic acid precipitation. The concentrated sample was analysed by SDS/PAGE (10% polyacrylamide). Amino acid sequencing of purified MREa-binding Ku ... nuclear extracts were incubated with avidin–agarose beads (Sigma) at 4 °C for 30 min to eliminate materials in the extracts that bind nonspecifically to the beads. After removing the beads...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo y học: "TPO, but not soluble-IL-6 receptor, levels increase after anagrelide treatment of thrombocythemia in chronic myeloproliferative disorders"
... Thus, a pronounced increase of TPO levels after 6 months of anagrelide treatment indicated that this treatment affected a major regulatory mechanism for megakaryocyte and platelet formation in ... and bleeding, risks that may be reduced with appropriate therapy. Anagrelide hydroxide is a platelet reducing compound, often used as an alternative to hydroxy- urea, interferon-α a...
Ngày tải lên: 03/11/2012, 10:52
Báo cáo Y học: Recombinant human glucose-6-phosphate dehydrogenase Evidence for a rapid-equilibrium random-order mechanism potx
... U o þ U X ½X þ U Y Y þ U XY ½X Y ð1Þ where X and Y are sugar phosphate and coenzyme, respectively. The four / parameters are obtained from initial-rate measurements at varying concentrations of X for a ... The initial-rate behaviour gives no indication of any complexities in NADP + binding. Alternative substrates An alternative substrate, when available, can be a useful tool...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo Y học: Amino acids 3–13 and amino acids in and flanking the 23FxxLF27 motif modulate the interaction between the N-terminal and ligand-binding domain of the androgen receptor pdf
... between both assays is the coupling of AR.NTD to GalAD in the yeast assay, and the absence of a second transactivation domain linked to AR NTD in the mammalian assay. The latter assay completely depends ... b-galactosidase assay was performed to quantify the interaction of GalAD-AR.NTDwt, GalAD- AR.NTDmutant and GalAD-ARpeptide proteins with GalDBD-AR.LBD. In short, stationary p...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Matrilysin (matrix metalloprotease-7) cleaves membrane-bound annexin II and enhances binding of tissue-type plasminogen activator to cancer cell surfaces docx
... monoclonal anti- body against tPA from Abcam (Cambridge, MA, USA); rabbit polyclonal antibody against enolase, mouse mono- clonal antibody against annexin II and rabbit polyclonal antibody against annexin ... N-(R)-[2-(hydrox- yaminocarbonyl)-methyl]-4-methylpentanoyl-l-naphthyl- alanyl-l-alanine-2-aminoethyl amide (TAPI-1), but not by a mixture of inhibitors for serine, aspartic and cyst...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo Y học: SMAP-29 has two LPS-binding sites and a central hinge docx
... found in sheep leuko- cytes, possesses potent activity against a broad range of microbial pathogens, including many Pseudomonas aeru- ginosa strains that are highly resistant to conventional antibiotics ... constraints u sed in SMAP-29 structure. Constraint type Number of constraints Intraresidue 64 Interresidue 106 One residue away 70 Two residues away 9 Three residues away 18 Four...
Ngày tải lên: 17/03/2014, 23:20