Báo cáo khoa học: A unique vertebrate histone H1-related protamine-like protein results in an unusual sperm chromatin organization pot

... The Authors Journal compilation ª 2006 FEBS 4561 A unique vertebrate histone H1-related protamine-like protein results in an unusual sperm chromatin organization Nu ´ ria Saperas 1 , Manel Chiva 2 , ... of chromosomal proteins that are closely linked to the main histone constituents of somatic chromatin [11]. These proteins are present in the chromatin of t...

Ngày tải lên: 08/03/2014, 08:20

... crystalline cellulose are gener- ally called cellobiohydrolases, and share similar two- domain structures, with a catalytic domain (CD) and a cellulose-binding domain (CBD) [7–10]. As the ini- tial ... I a -rich and I b ). The adsorption parameters (K ad1 , K ad2 , A 1 , A 2 , A max , A 1 ÆK ad1 , and A 2 ÆK ad2 ) listed in Table 1 show that the difference made by ammonia tr...

Ngày tải lên: 23/03/2014, 09:21

... clearly showed that the majority of the material constituted of a tetrasaccha- ride and a smaller amount of a tetrasaccharide-ribitol. The data shows that the AAT residue is indeed an acetamido-amino ... [1]. Structural analysis demonstrated that this S. mitis biovar 1 strain possesses a true C-polysaccharide in addition to a unique glycan. The C-polysaccharide found in all...

Ngày tải lên: 20/02/2014, 11:20

... total RNA was reverse- transcribed and PCR-amplified using proofreading DNA polymerase (Invitrogen), forward primer 5¢-TTCCTGC AGTGGAAACCGGCAGTGAGGCCA-3¢ and reverse primer 5¢-CGGAAAACCATCGCTAACAACTAAGCTT GGG-3¢. ... this steric hindrance may have conferred an advantage on deer Hp that compensates for the undesired tandem repeat in the a- chain. Experimental procedures Animal plasma Anima...

Ngày tải lên: 23/03/2014, 07:20

... current binding-site models and to gain insight into the design of additional salvinorin A analogues. A tentative model is also proposed to explain previous and new data on salvinorin A binding to the opioid ... Because such an interaction is not present in salvinorin A, an alternative approach must be undertaken. In these cases, a common starting point for examining nascent...

Ngày tải lên: 30/03/2014, 11:20

... tandem MS. Abbreviations AAL, Aleuria aurantia lectin; AFP, a- fetoprotein; GGDB, GlycoGene Database; GlycoProtDB, GlycoProtein Database; GMDB, Glycan Mass Spectral Database; HCC, hepatocellular ... between cancer and normal cells enables identification of aberrant glycosylation in cancer [indicated as a red triangle in (B) and (C)] as an alteration in lectin signal pattern. Accordi...

Ngày tải lên: 16/02/2014, 08:20

... GGAGCAAGAGGTTCAGCATC MLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAA MLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTG MLL4 GTCTATGCGCAGTGGAGACA AGTCTGCATCCCCGTATTTG HOXC13-ERE1 GCGTCTCCCTGTCCCTTTA CAGGTCTCCTGGGGTTCC HOXC13-ERE2 ... TTGCCGAGTATATTCCATTGC TCTGCTTTACCTCGCTGGAT HOXC13-ERE3 TTTCAGGCCCTTTGTTTCTC CGCGGGTAGTAGAAGTGGAA HOXC13-ERE4 TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACC ERa antisense...

Ngày tải lên: 18/02/2014, 14:20

... of natural and man-made organic compounds, among them the tobacco alkaloid nicotine. Perhaps analysed in greatest detail is the pathway of nicotine degradation as it takes place in Arthrobacter ... Replace- ment of tryptophan with serine (W66S), also abolished covalent binding of FAD a nd resulted in an inactive enzyme variant. However, this inactivation was accompanied by a drast...

Ngày tải lên: 19/02/2014, 16:20

... are shown on a gray background. (B) A scleractinian coral, Cyphastrea microphthalma, collected in 1.2 m of water off Lizard Island on the Aus- tralian Great Barrier Reef. (C) Overlay of the absorption ... York. 44 Karasawa S, Araki T, Yamamoto-Hino M & Miyawaki A (2003) A green-emitting fluorescent protein from Galaxeidae coral and its monomeric version for use in fluorescent...

Ngày tải lên: 06/03/2014, 11:20

... interface of human manganese superoxide dismutase. Biochemistry 47, 4621–4628. 18 Vandegriff KD, Malavalli A, Minn C, Jiang E, Lohman J, Young MA, Samaja M & Winslow RM (2006) Oxidation and ... dismutase–catalase supplies oxygen without causing blood–brain barrier disruption or brain edema in a rat model of transient global brain M. Grey et al. An Hb fusion protein with antioxida...

Ngày tải lên: 07/03/2014, 00:20