Báo cáo khoa học: A unique vertebrate histone H1-related protamine-like protein results in an unusual sperm chromatin organization pot
... The Authors Journal compilation ª 2006 FEBS 4561 A unique vertebrate histone H1-related protamine-like protein results in an unusual sperm chromatin organization Nu ´ ria Saperas 1 , Manel Chiva 2 , ... of chromosomal proteins that are closely linked to the main histone constituents of somatic chromatin [11]. These proteins are present in the chromatin of t...
Ngày tải lên: 08/03/2014, 08:20
... crystalline cellulose are gener- ally called cellobiohydrolases, and share similar two- domain structures, with a catalytic domain (CD) and a cellulose-binding domain (CBD) [7–10]. As the ini- tial ... I a -rich and I b ). The adsorption parameters (K ad1 , K ad2 , A 1 , A 2 , A max , A 1 ÆK ad1 , and A 2 ÆK ad2 ) listed in Table 1 show that the difference made by ammonia tr...
Ngày tải lên: 23/03/2014, 09:21
... clearly showed that the majority of the material constituted of a tetrasaccha- ride and a smaller amount of a tetrasaccharide-ribitol. The data shows that the AAT residue is indeed an acetamido-amino ... [1]. Structural analysis demonstrated that this S. mitis biovar 1 strain possesses a true C-polysaccharide in addition to a unique glycan. The C-polysaccharide found in all...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo khoa học: A unique tetrameric structure of deer plasma haptoglobin – an evolutionary advantage in the Hp 2-2 phenotype with homogeneous structure pot
... total RNA was reverse- transcribed and PCR-amplified using proofreading DNA polymerase (Invitrogen), forward primer 5¢-TTCCTGC AGTGGAAACCGGCAGTGAGGCCA-3¢ and reverse primer 5¢-CGGAAAACCATCGCTAACAACTAAGCTT GGG-3¢. ... this steric hindrance may have conferred an advantage on deer Hp that compensates for the undesired tandem repeat in the a- chain. Experimental procedures Animal plasma Anima...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: A unique binding epitope for salvinorin A, a non-nitrogenous kappa opioid receptor agonist docx
... current binding-site models and to gain insight into the design of additional salvinorin A analogues. A tentative model is also proposed to explain previous and new data on salvinorin A binding to the opioid ... Because such an interaction is not present in salvinorin A, an alternative approach must be undertaken. In these cases, a common starting point for examining nascent...
Ngày tải lên: 30/03/2014, 11:20
Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt
... tandem MS. Abbreviations AAL, Aleuria aurantia lectin; AFP, a- fetoprotein; GGDB, GlycoGene Database; GlycoProtDB, GlycoProtein Database; GMDB, Glycan Mass Spectral Database; HCC, hepatocellular ... between cancer and normal cells enables identification of aberrant glycosylation in cancer [indicated as a red triangle in (B) and (C)] as an alteration in lectin signal pattern. Accordi...
Ngày tải lên: 16/02/2014, 08:20
Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx
... GGAGCAAGAGGTTCAGCATC MLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAA MLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTG MLL4 GTCTATGCGCAGTGGAGACA AGTCTGCATCCCCGTATTTG HOXC13-ERE1 GCGTCTCCCTGTCCCTTTA CAGGTCTCCTGGGGTTCC HOXC13-ERE2 ... TTGCCGAGTATATTCCATTGC TCTGCTTTACCTCGCTGGAT HOXC13-ERE3 TTTCAGGCCCTTTGTTTCTC CGCGGGTAGTAGAAGTGGAA HOXC13-ERE4 TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACC ERa antisense...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt
... of natural and man-made organic compounds, among them the tobacco alkaloid nicotine. Perhaps analysed in greatest detail is the pathway of nicotine degradation as it takes place in Arthrobacter ... Replace- ment of tryptophan with serine (W66S), also abolished covalent binding of FAD a nd resulted in an inactive enzyme variant. However, this inactivation was accompanied by a drast...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: A new bright green-emitting fluorescent protein – engineered monomeric and dimeric forms pptx
... are shown on a gray background. (B) A scleractinian coral, Cyphastrea microphthalma, collected in 1.2 m of water off Lizard Island on the Aus- tralian Great Barrier Reef. (C) Overlay of the absorption ... York. 44 Karasawa S, Araki T, Yamamoto-Hino M & Miyawaki A (2003) A green-emitting fluorescent protein from Galaxeidae coral and its monomeric version for use in fluorescent...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: A superoxide dismutase–human hemoglobin fusion protein showing enhanced antioxidative properties pptx
... interface of human manganese superoxide dismutase. Biochemistry 47, 4621–4628. 18 Vandegriff KD, Malavalli A, Minn C, Jiang E, Lohman J, Young MA, Samaja M & Winslow RM (2006) Oxidation and ... dismutase–catalase supplies oxygen without causing blood–brain barrier disruption or brain edema in a rat model of transient global brain M. Grey et al. An Hb fusion protein with antioxida...
Ngày tải lên: 07/03/2014, 00:20