Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf
... Biochem. 270) 3857 Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C Yashoda Ghanekar, ... colonic cell lines to ST peptides induces cellular refractoriness to the ST peptide, in terms of intra- cellular cGMP accumula...
Ngày tải lên: 08/03/2014, 08:20
... Ricin is a heterodimeric ribosome-inactivating protein that accu- mulates in castor beans (Ricinus communis). The mature ricin comprises a catalytic A chain and a B chain linked by a single disulfide ... brefeldin A-insensitive and is inhibited by the proteasome inhibitor clasto-lactacystin b-lactone, resulting in the accumulation of ricin A chains. These stabilized ricin A cha...
Ngày tải lên: 16/03/2014, 11:20
... likely to encounter PDIs there. Indirect support for the involvement of PDIs in PE intoxication comes from the pathways of other protein toxins. The protein toxins ricin and cholera toxin (CT) both ... cellular uptake through receptor-mediated endocytosis for activity. The overall structure of these proteins consists of a receptor-binding domain (B subunit) linked to a...
Ngày tải lên: 22/03/2014, 15:21
Báo cáo khoa học: Catalytic residues Lys197 and Arg199 ofBacillus subtilis phosphoribosyl diphosphate synthase Alanine-scanning mutagenesis of the flexible catalytic loop ppt
... (pHO380), 5¢-CGCCGTCCGCGTCCA GCTGTGGCGGAAGTCATGAATATTGTAGGTAACATC GAAGGG and 5¢-CCCTTCGATGTTACCTACAATATTC ATGACTTCCGCCAC AGCTGGACGCGGACGGCG for N203A (pHO392), 5¢-CGCCGTCCGCGTCCAAAC GCCG CGGAAGTCATGAATATTGTAGGTAACATCGAAGGG and ... 5¢-GCGATTATCGA TAAA GCGCGTCCGCGTCC and 5¢-GGACGCGGACG CGCTTTATCGATAATCGC for R198A, which resulted in pAB701, 5¢-CGATAAACGC GCGCCGCGTCC and 5¢- GGACGCGG CGCGCGTTT...
Ngày tải lên: 23/03/2014, 15:20
Báo cáo khoa học: From meiosis to postmeiotic events: Homologous recombination is obligatory but flexible doc
... and the cyclin-dependent kinase Cdc28 in complex with the B-type cyclin Clb5–Clb6, provides a functional link between replication and DSB forma- tion [94] by modulating the loading of interacting ... to the sequence-speci c DNA-binding domain of Gal4 (Gal4BD–Spo11) or to the synthetic zinc-finger motif (QQR–Spo11) is sufficient to target DSB formation to regions con...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo khóa học: Genetic approaches to the cellular functions of polyamines in mammals potx
... related directly to the polyamines – oxidative stress or inadequate synthesis of nucleic acids and proteins in the absence of the polyamines – or, in the case of ODC deficiency, an excessive accumulation ... polymorphism in ODC gene is a prognostic indicator, especially in combination with the use of aspirin, for the recurrence of adenomas [161]. The singl...
Ngày tải lên: 30/03/2014, 13:20
Tài liệu Báo cáo khoa học: Chemical approaches to mapping the function of post-translational modifications ppt
... subsequently used for the monitoring of acute and chronic in ammation in mammalian brain tissue both in vitro and in vivo, including in the detection of cerebral malaria. Retooling of this reporter system ... results in the formation of so-called ‘glycoforms’ [11,12], proteins with the same peptide backbone that differ in the nature and site of glycan inco...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: From heart to mind The urotensin II system and its evolving neurophysiological role ppt
... sequenced to date [17]. The major biologically active part of both molecules consists of a canonical cysteine bridged hexapeptide ring with the sequence CFWKYC, also known as core, which is invariant ... far contain an acidic amino acid residue (aspartic or glutamic acid) that directly precedes its cyclic core structure (Fig. 1) [2]. This particular amino acid is absent in U...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Covalent binding to glutathione of the DNA-alkylating antitumor agent, S23906-1 doc
... for the cytotoxic action [12] and the capacity of the drug to trigger apoptosis in tumor cells [13,14]. In the course of our ongoing studies aimed at characterizing the interaction of S23906-1 with ... At the cellular level, the presence of GSH slightly reduces the cytotoxic potential of S23906-1 towards KB-3-1 epidermoid carcinoma cells. The GSH-induced...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo khoa học: Ibuprofen binding to secondary sites allosterically modulates the spectroscopic and catalytic properties of human serum heme–albumin doc
... reflect drug-dependent structural changes occurring at the heme-binding pocket (FA1). Indeed, ibuprofen binding to HSA–heme has been reported to induce the hexa-coordination of the heme Fe atom ... instead predominantly penta-coordinated in the absence of allosteric effectors. Indeed, high (> 1.0 · 10 )3 m) ibu- profen concentration clearly induces the coordination of...
Ngày tải lên: 06/03/2014, 01:20