Báo cáo khoa học: "PENS: A Machine-aided English Writing System for Chinese Users" pdf

... this translation, and therefore a Chinese -English bilingual dictionary (MRD), an English language model, and an English- Chinese word- translation model (TM) are needed. The English language model ... word/phrase level automatic translation with translation memory will achieve a better solution to machine-aided English writing system [Zhou, 95]. In this paper, we propos...

Ngày tải lên: 08/03/2014, 05:20

... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptually, ... messages in microblogs. Our system can be regarded as a sentiment-driven, music-based sum- marization framework as well as a novel audiovis- ual presentation of art. MemeTube is designed a...

Ngày tải lên: 20/02/2014, 05:20

... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and...

Ngày tải lên: 18/02/2014, 14:20

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... African trypanosome Trypanosoma brucei is the protozoon that causes the fatal human sleeping sickness, as well as Nagana, a devastating...

Ngày tải lên: 19/02/2014, 12:20

... Abstract We will demonstrate the ModelTalker Voice Recorder (MT Voice Recorder) – an interface system that lets individuals record and bank a speech database for the creation of a synthetic ... screened for pitch, amplitude and pronuncia- tion and users are given immediate feedback on the acceptability of each recording. Users can then rerecord an unacceptable utterance....

Ngày tải lên: 20/02/2014, 09:20

... Translating a Unification Grammar with Disjunctions into Logical Constraints Mikio Nakano and Akira Shimazu* NTT Basic Research Laboratories 3-1 Morinosato-Wakamiya, Atsugi 243-0198 Japan ... unification-based approach is that it enables us to describe grammar declaratively, making the development and amendment of grammar easy. Analysis systems that are based on unification gram- ma...

Ngày tải lên: 20/02/2014, 18:20

... not apply. Knott and Mellish [1996] provide an apt summary of the situation. Their 'test for relational phrases' is a good start, but geared towards the English language (we are ... found a cheap bar. If one accepts these sentences as paraphrases, then the various discourse markers all need to be associated with the information that they sig- nal a concessive rela...

Ngày tải lên: 20/02/2014, 18:20

... syntax-based approach. 1. Introduction In a large natural language processing system, such as a machine translation system (MTS), am- biguity resolution is a critical problem. Various rule-based and ... general, a particular semantic interpretation of a sentence can be characterized by a set of lexical categories (or parts of speech), a syntactic struc- ture, and the s...

Ngày tải lên: 20/02/2014, 21:20

... Extracting Relations Nanda Kambhatla IBM T.J. Watson Research Center 1101 Kitchawan Road Rt 134 Yorktown, NY 10598 nanda@us.ibm.com Abstract Several NLP tasks are characterized by asymmetric data where ... asymmetry in the data and the imbalance between precision and recall in the classifiers. 4 The ACE Relation Extraction Task Automatic Content Extraction (ACE) is an annual evaluation conduct...

Ngày tải lên: 20/02/2014, 12:20

... in (Al-Onaizan and Knight, 2002) or (AbdulJaleel and Larkey, 2003) require a large set of sample transliterations to use for training. If such a training set is unavailable for a particular language pair, ... fact that names are sometimes split differently in Arabic and English. The Arabic (2 words) is generally written as Abdallah in English, leading to partial matches with part...

Ngày tải lên: 08/03/2014, 02:21