Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... to have a molecular mass of 64 kDa, and to contain two tandem repeats and a Glu-rich region. The structure of the protein and that of its DNA are similar to those of starmaker, a protein involved in ... 3. 45 Ca overlay analysis of fusions of GST and recombinant OMM-64 variants (rOMM-64-I-V and -C), containing different domains of the protein, to determine the calcium-...

Ngày tải lên: 18/02/2014, 17:20

12 569 0
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

... Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide Andrew D. Cox 1 , J. Claire Wright 2 , Margaret A. J. Gidney 1 , Suzanne Lacelle 1 , ... lipopolysaccharide; mass spectrometry; Neisse- ria meningitidis; NMR; oligosaccharide. The lipopolysaccharide (LPS) of Neisseria meningitidis contains a core oli...

Ngày tải lên: 08/03/2014, 02:20

8 361 1
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

... G GAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC 3+ wt GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC 3+ YIRN GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG 3– GGAATTCTGCAGTTAGCATTTgagCTCtccCTTGCACAAgAAGTCCGG Ó FEBS 2003 A novel ... GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG 2a+ GACTGCAaCCCCAAAtCGGACAG 2b+ CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTG...

Ngày tải lên: 17/03/2014, 03:20

8 401 0
Báo cáo khoa học: Identification of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt

Báo cáo khoa học: Identification of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt

... The cDNA was amplified from U66003 using primers U660035Eco2 (5¢-AATAGA GAATTCAGAGAAAGAGATACGAGATGGA-3¢) and U660033Not (5¢-TCATAAGGCGGCCGCCTACATCG ATCTTAATCTGCTCAA-3¢). A fragment carrying At3g21260 ... (5¢-AGACTGCTCTAGAATG GGTTTCTAAACCAACACGT-3¢) and GLTP1PRON- BAM (5¢-CTCCTTGGATCCGCCTGAGAATTGAAAAA GGTGGG-3¢). A 1.3 kb fragment carrying the At1g21360 promoter was amplified using primers 2...

Ngày tải lên: 23/03/2014, 07:20

17 300 0
Báo cáo khoa học: Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues ppt

Báo cáo khoa học: Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues ppt

... for angiotensin II receptor (AT 1a) cDNA cloning: 5¢-CGCGGATGAAGAAAATGAAT-3¢ (forward); 5¢-CCCTTTGGAAACTGGACAGA-3¢ (reverse). Primers used for cannabinoid receptor-1 (CB-1) cDNA cloning: 5¢-GAGGACCAGGGGATGCGAAGG-3¢;5¢-TG CCCCCTGTGGGTCACTTTCT-3¢. Plasmids ... Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues Yanbin Liang, Chen Li, Victor M....

Ngày tải lên: 23/03/2014, 13:20

9 312 0
Báo cáo khoa học: Identification of a novel thyroid hormone-sulfating cytosolic sulfotransferase, SULT1 ST5, from zebrafish Molecular cloning, expression, characterization and ontogenic study ppt

Báo cáo khoa học: Identification of a novel thyroid hormone-sulfating cytosolic sulfotransferase, SULT1 ST5, from zebrafish Molecular cloning, expression, characterization and ontogenic study ppt

... Sense: 5¢-ACACTCTGAAGGGGAATTAGGATTAAGAAA-3¢ Antisense: 5¢-CTGACTATACAAGGCTGTGTGCCACAAAAC-3¢ SULT1 ST5 Sense: 5¢-GAAAACACATCACGTACCCTCCCTCTCTGCG-3¢ Antisense: 5¢-ACATCATGGTATATTATTCATTTAGCTGACACTTT-3¢ b-Actin ... Sense: 5¢-TATGTAGGAGCTACAAGAAACATTGAAGGC-3¢ Antisense: 5¢-CAATTCTTACTAGCTGCAGGGAGGGTTGGT-3¢ SULT1 ST3 Sense: 5¢-GAATTGGCCCTAATTTGCACATTAAAGATA-3¢ Antisense: 5¢-GCCTGAAGTTTTTGGTTCACAGT...

Ngày tải lên: 23/03/2014, 15:20

10 336 0
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

... gene product, a DNA-binding protein. Proc.NatlAcad.Sci.USA78, 2043–2047. 13. Neuwald ,A. F.,Aravind,L.,Spouge,J.L.&Koonin,E.V.(1999) AAA+: a class of chaperone-like ATPases associated with the assembly, ... The standard curve was plotted with the logarithm of molecular mass against V e /V 0 of the standard protein. Peptidase and ATPase assays The peptidase activity of Bt-Lon w...

Ngày tải lên: 16/03/2014, 16:20

11 505 0
Báo cáo khoa học: Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics pdf

Báo cáo khoa học: Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics pdf

... 5¢-ACTCAAATCACTAGTATTCTTCCACCA-3¢ and 5¢-CATTTGAACATAAACATGAACAAATAAGTT-3¢ and the following conditions: annealing temperature 55 °C, 25 cycles, Phusion polymerase used according to the manufacturer’s ... home-made databases that contain either a six frame-translation of C. papaya ESTs or a six-frame translation of C. papaya whole genome shotgun sequences. These databases were constru...

Ngày tải lên: 22/03/2014, 17:20

14 395 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

... N-Terminal processing would lead to a mature protein of 732 amino acids with a theoretical molecular mass of 78 kDa. A search in the PROSITE database of protein families and domains [12] with MCA2590 ... GGCAACGAGCAAGGTCCGAAG sapE–R 2590 R GACGTCGTGAGTGCCTCCGTG mopB–F 3103 F CGACGTGCAGTATTACTTTTCTAGGG mopB–R 3103 R AGTATCAAACCGTGCTGGTCTCC Heme protein identification in M. cap...

Ngày tải lên: 23/03/2014, 11:20

12 392 0
Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf

Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf

... Department of Bioscience and Bioinformatics, Kyushu Institute of Technology, Iizuka, Fukuoka, Japan 2 Department of Biological Sciences, Faculty of Science, Kanagawa University, Hiratsuka, Kanagawa, Japan Although ... 4, bovine liver ferritin; lanes 2 and 5, bovine adrenal gland ferritin; and lanes 3 and 6, the 250 kDa protein. Identification of a putative MAP as ferritin M. R. H...

Ngày tải lên: 23/03/2014, 13:20

10 232 0
w