Báo cáo khoa học: "Creating a Gold Standard for Sentence Clustering in Multi-Document Summarization" potx
Báo cáo khoa học: "Creating a Gold Standard for Sentence Clustering in Multi-Document Summarization" potx
... first
step in Multi-Document Summarization
(MDS) to find redundant information. All
the same there is no gold standard avail-
able. This paper describes the creation
of a gold standard for sentence ... 2000). In sentence clustering se-
mantically similar sentences are grouped together.
Sentences within a cluster overlap in information,
but they do not have to be iden...
Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx
... Educational Applications, pages 28–36.
Alla Rozovskaya and Dan Roth. 2010b. Training
paradigms for correcting errors in grammar and us-
age. In Proc. of 2010 Annual Conference of the North
American ... North
American Chapter of the ACL, pages 154–162.
Joel Tetreault, Elena Filatova, and Martin Chodorow.
201 0a. Rethinking grammatical error annotation and
evaluation with the Amazon Mecha...
Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx
... look in its neighbourhood for the opti-
mal candidate as target paragraph.
We perform two kinds of tests on the paragraphs
in this span: a test of paragraph content, and a test
of paragraphs relative ... Fips
Collocations are extracted from syntactically ana-
lysed corpora. The analysis is performed by Fips, a
large-scale parser based on an adaptation of
Chomksy's "Princ...
Báo cáo khoa học: "Creating a Corpus of Parse-Annotated Questions" docx
... re-
search established that even a small amount of ad-
ditional training data can give a substantial im-
provement in question analysis in terms of both
CFG parse accuracy and LFG grammatical func-
tional ... Ques-
tionBank provides a useful new resource
in parser-based QA research.
1 Introduction
Parse-annotated corpora (treebanks) are crucial for
developing machine learning an...
Báo cáo khoa học: "Creating a CCGbank and a wide-coverage CCG lexicon for German" pdf
... training data.
On the other hand, formalisms such as CCG and
TAG a re particularly suited to capture the cross-
ing dependencies that arise in languages such as
Dutch or German, and by choosing ... inadequate
context-free approximations.
505
1. Standard main clause
Peter gibt Maria das Buch
2. Main clause with fronted adjunct 3. Main clause with fronted complement
dann gibt Peter Maria...
Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" ppt
... look in its neighbourhood for the opti-
mal candidate as target paragraph.
We perform two kinds of tests on the paragraphs
in this span: a test of paragraph content, and a test
of paragraphs relative ... Fips
Collocations are extracted from syntactically ana-
lysed corpora. The analysis is performed by Fips, a
large-scale parser based on an adaptation of
Chomksy's "Princ...
Tài liệu Báo cáo khoa học: "Archivus: A multimodal system for multimedia meeting browsing and retrieval" doc
... considered and controlled
for in the experiment increases substantially. For
instance, if it is the case that within a single inter-
face any task that can be performed using natural
language can also ... meeting browsing and
retrieval
Marita Ailomaa, Miroslav Melichar,
Martin Rajman
Artificial Intelligence Laboratory
´
Ecole Polytechnique F
´
ed
´
erale de Lausanne
CH-1015 Lausanne, S...
Tài liệu Báo cáo khoa học: "Outilex, a Linguistic Platform for Text Processing" pdf
... processing: text seg-
mentation, morphosyntactic tagging, parsing with
grammars and language resource management.
All Language Resources are structured in XML
formats, as well as binary formats ... flexibility: a lexicon or a
grammar is not a static resource. The management
of lexicons and grammars implies manual con-
struction and maintenance of resources in a read-
able format, a...
Tài liệu Báo cáo khoa học: "TOWARDS A CORE VOCABULARY FOR SYSTEM A NATURAL LANGUAGE" potx
... eliminate arbitrariness. Rather, a
definition of representative corpus must take
into
account tile research goals pursued.
For a natural language system which is sup-
posed
to
analyze and ... here
allows for a balanced extension of this very smaU
core. The list//3 was chosen as the statistical core
vocabulary serving as a base for applying se-
mantic criteria, becat, s...
Báo cáo khoa học: Adenine, a hairpin ribozyme cofactor – high-pressure and competition studies potx
... 5¢-CCTCCGAAACAGGACTGTCAGGGGG
TACCAGGTAATGCATCACAACGTTTTCACGGTTGA
TTCTCTGTTTCAGCGTACCC-3¢. The two primer bind-
ing regions are located in the 5¢-terminus and 3¢-terminus.
A 4 mL PCR reaction with each ... replaced by an abasic
analog [27]. It was observed that 2,6-diaminopurine
was significantly more efficient than adenine in restor-
ing the catalytic activity. In an attempt to obtain a...