Báo cáo khoa học: "Distributed Listening: A Parallel Processing Approach to Automatic Speech Recognition" pot

... known as a unigram. The grammar consists of known utterances that can be made by the user. The unigram grammar is stored in a phrase database. The grammar is organized according to individual ... the accuracy of the transcription of spoken utterances. 1 Introduction Research in the area of natural language processing has been on-going for over thirty years (Natural Language...

Ngày tải lên: 08/03/2014, 01:20

... (primers 5¢-GAGGATCCATGGAACAGAACA GGTTCAAG-3¢ and 5¢-CGGAATTCTTACAGTTTTTGT TTAGTCGTTTTAAC-3¢) was subcloned into EcoRV- digested pBluescript SK + , and then cloned into the BamHI and EcoRI sites ... (systematic name: Yor084wp) was extractable by low salt and identified together with the peroxisomal aspartate aminotransfer- ase Aat2p in HPLC fraction 7 at a molecular mass of approximately 45...

Ngày tải lên: 07/03/2014, 05:20

... approaches: These approaches crucially rely on lexical knowledge base. Graph-based WSD approaches (Agirre and Soroa, 2009; Sinha and Mihalcea, 2007) per- form disambiguation over a graph composed of ... of a feature vector and models were built by training on sense-tagged corpora. These approaches pose WSD as a classification problem. They crucially rely on hand-tagged sense corpora whic...

Ngày tải lên: 20/02/2014, 04:20

... harm or an increase in patient monitoring with no change in vital signs and no harm noted. Moderate errors were classified as those causing an increase in patient monitoring, a change in vital ... rate analysis. The patient outcome from each error were assigned by the pharmacist and the ICU clinical director, according to an adapted scale [9-11]. Minor errors were classified as those caus...

Ngày tải lên: 25/10/2012, 10:39

... substantia nigra is a neuropathological hallmark of Parkinson’s disease. This leads to a decreased level of dopamine in the striatum. As a result, synaptic transmission is nega- tively affected ... protective action of rasagiline, a MAO-B inhib- itor, on the aggregation of a- synuclein, is because of its action as a free radical scavenger [36]. Thus, it may be speculated that dop...

Ngày tải lên: 14/02/2014, 19:20

... Chang CK (1994) Heme d 1 and other heme cofactors from bacteria. Ciba Found Symp 180, 228–238. 24 Van Spanning RJ, Wancell CW, De Boer T, Hazelaar MJ, Anazawa H, Harms N, Oltmann LF & Stouthamer AH ... the total cell lysate and the periplasmic fraction, but was absent from the membrane and cytoplasmic fractions. (B) The same cell fractions as shown in (A) when sub- jected to SDS ⁄ PAGE...

Ngày tải lên: 15/02/2014, 01:20

... red). Table 1. Average distances between CA atoms of the stefins and catalytic residues of cysteine proteases. Distance calculated d (A ˚ ) Papain–stefin B 23.93 Cathepsin H–stefin A 23.36 ± 0.23 Cathepsin ... the P1 data set is a consequence of highly anisotropic diffrac- tion, which forced us to discard part of the collected data to maintain reasonable merging statistics. The anisotro...

Ngày tải lên: 18/02/2014, 04:20

... GAACCAATGAAATAAGGGCG cyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 ... CGTATAAATTACAATACCG Spcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAAT...

Ngày tải lên: 18/02/2014, 14:20

... PCR with Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG- 3¢. The cDNA was subcloned into the EcoRV ... that mammalian Gup1, a mem- ber of the MBOAT superfamily bearing sequence simi- larity to HHAT, acts as a negative regulator of N-terminal palmitoylation of Shh. Several reports have demonstra...

Ngày tải lên: 18/02/2014, 16:20

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotak...

Ngày tải lên: 18/02/2014, 17:20