Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx

... Parallel Processing, Bulgarian Academy ofSciences, nakov@lml.bas.bgare taking the GRE test nowadays are familiar withan instance of this problem – verbal analogy ques-tions, which ask whether, ... yielding 47% accuracy. The same ap-proach is applied to classifying noun-modiﬁer pairs: using the Diverse dataset of Nastase and Szpakow-icz (2003), Turney&Littman achieve F-measures of26.5% ... evaluation.Given a verbal analogy example, we build six fea-ture vectors – one for each of the six word pairs. Wethen calculate the relational similarity between the stem of the analogy and each of the...

Báo cáo khoa học: "Automatic Set Instance Extraction using the Web" pptx

... paper, we evaluate a novel approach tothis problem, embodied in a system called ASIA1(Automatic Set Instance Acquirer). ASIA takes a semantic class name as input (e.g., “car makers”)and automatically ... 2007b)We compare ASIA to Pasca (Pas¸ca, 2007b) andpresent comparison results in Table 3. There areten semantic classes in his evaluation dataset, and the input to his system for each class is a set ... entities rather than a class name. We evaluateevery instance manually for each class. The resultsshow that, on average, ASIA performs better.However, we should emphasize that for the three classes:...

Tài liệu Báo cáo khoa học: Identiﬁcation of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... stop assayThis assay was adapted from the method described byHan et al. [43]. The 25-mer primer was 5¢-labeled with32P, mixed with the 76-mer template DNA and annealed as described above. The ... reverse d(GAA CAT TCC ACCGGG ACC ACC AC). pGEX–KGG3-4 was generated byPCR using pGEX–KGG2 as a template and the followingprimers: KGG3-4 forward d(AGA CAA AGG TGG CTTCAA AGG TGG CCG) and KGG3-4 ... ACA G)and EWS reverse d(CGC TCG AGT CAC TAG TAG GGCCGA TCT CTG C), for pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA GAC...

Tài liệu Báo cáo khoa học: Local stability identiﬁcation and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... DNA was isolated with the GFXTMMicro Plas-mid Prep Kit (Amersham Pharmacia Biotech, Piscataway,NJ, USA), and the resulting dsDNA was mixed with 8 lLBigDyeTMmaster mix (BigDyeTMTerminator ... from the DSC curve. The enthalpychange (DHcal) of each protein was calculated by integra-tion of the curve covering area (Tmwas taken as the curve peak point) using origin software.AcknowledgementsThis ... sites of SNase maystart from the N-terminus [25]. However, we used the C-terminal fragments SNase(1–140) and SNase(1–142)to show that SNase(1–140) plays a role in the assemblyof the protein...

Tài liệu Báo cáo khoa học: "ModelTalker Voice Recorder – An Interface System for Recording a Corpus of Speech for Synthesis" ppt

... feedback mechan-ism also helps to eliminate cases in which the sys-tem is unable to accurately track the pitch of an utterance. In these cases, the utterance will be marked unacceptable and the ... recording on the part of the speaker, this is the approach the ModelTalker Syn-thesizer has taken. However using smaller units may result in noticeable auditory glitches at conca-tenative junctures ... approximately 2 million people in the United States with a limited ability to commu-nicate vocally (Matas et al., 1985), these synthetic voices are inadequate. The restricted number of available...

Tài liệu Báo cáo khoa học: "Organizing Encyclopedic Knowledge based on the Web and its Application to Question Answering" ppt

... (Hearst,1992; Nakamura and Nagao, 1988) and natural lan-guage understanding in general.Among the above applications, natural language un-derstanding (NLU) is the most challenging from a sci-entiﬁc ... dictionary, butdecreased the accuracy. However, by combining bothresources, the accuracy was noticeably improved, and the coverage was comparable with that for the Nichi-gai dictionary.On the other ... other hand, in the case where random choicewas performed, the Nichigai dictionary and the Web- based encyclopedia were comparable in terms of both the coverage and accuracy. Additionally, by...

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... hnRNP A1 CUAGACUAGA 5428–5437ESE2 SC35, SRp40 CCAGUAGAUCCUAGACUAGA 5418–5437 A5 ESE GAR ASF ⁄ SF2, SRp40 GAAGAAGCGGAGACAGCGACGAAGA 5558–5582 [7] A7 ESS3 hnRNP A1 ,hnRNP E1 ⁄ E2AGAUCCAUUCGAUUAGunknown8047–8062 ... 32]ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950ESE3 ASF ⁄ SF2 GAAGAAGAA 8016–8025hnRNP A1 UAGAAGAAGAA 8018–8025HIV-1 alternative splicing regulation J. Tazi et al.872 FEBS Journal 277 (2010) ... spliced tat, rev and nef mRNAs [9],which are transported to the cytoplasm for translationof the Tat, Rev and Nef proteins (Fig. 2). All the tatmRNAs are spliced at site A3 . The rev mRNAs arespliced...

Báo cáo khoa học: Arginine-induced conformational change in the c-ring ⁄a-subunit interface of ATP synthase ppt

... removal of the harmonic restraints on the backboneatoms around the binding pocket. Manual placement ofaI225–aM231, as well as visualization of the results ofenergy minimization, was performed using ... the interacting helical faces of subunits a and c from the I. tartaricus ATP synthase has been mapped. According tothese data, the essential stator arginine (aR226) is located between the c-ring ... Na+ion. Again, the uncoordi-nated side chain of the cY70 might be displaced (notinto the cavity, however) and act as gate to the vesti-bule.Surprisingly, the cT67C mutant was also unable tosynthesize...

Báo cáo khoa học: "Compiling French-Japanese Terminologies from the Web" pptx

... MWTs in the source and target language. Second, we validate candidate translations using a set of terms collected from the web, rather than using empirical evidence from the web as a whole. ... in the litera-ture (Baldwin and Tanaka (2004), Cao and Li, Langkilde and Knight (1998)). 3.1 Translation Candidates Generation Translation candidates are generated using a compositional ... compositionally translated MWTs. As opposed to previous work, we use the web rather than comparable corpora as a source of bilingual data. Our main insight is to constrain source and target candidate...

Báo cáo khoa học: "Learning to Extract Relations from the Web using Minimal Supervision" ppt

... i.e.P (w |a) = C(w, a) /C (a) . Because this may be anoverestimate (w may appear in a sentence contain-ing a due to causes other than a) , and also becauseof data sparsity, the quantity τ(w) may sometimesresult ... are classiﬁed based on the unordered words contained in the sentence. Thisbaseline shows the performance of a standard text-classiﬁcation approach to the problem using a state-of -the art algorithm ... Pﬁzer TevaTable 1: Corporate Acquisition Pairs. Using a limited set of entity pairs (e.g. those inTable 1) and their associated bags as training data, the aim is to induce a relation extraction...

Xem thêm