Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx

... Parallel Processing, Bulgarian Academy of Sciences, nakov@lml.bas.bg are taking the GRE test nowadays are familiar with an instance of this problem – verbal analogy ques- tions, which ask whether, ... yielding 47% accuracy. The same ap- proach is applied to classifying noun-modifier pairs: using the Diverse dataset of Nastase and Szpakow- icz (2003), Turney&Littman achieve F-measur...

Ngày tải lên: 08/03/2014, 01:20

... paper, we evaluate a novel approach to this problem, embodied in a system called ASIA 1 (Automatic Set Instance Acquirer). ASIA takes a semantic class name as input (e.g., “car makers”) and automatically ... 2007b) We compare ASIA to Pasca (Pas¸ca, 2007b) and present comparison results in Table 3. There are ten semantic classes in his evaluation dataset, and the input to his system...

Ngày tải lên: 08/03/2014, 00:20

... stop assay This assay was adapted from the method described by Han et al. [43]. The 25-mer primer was 5¢-labeled with 32 P, mixed with the 76-mer template DNA and annealed as described above. The ... reverse d(GAA CAT TCC ACC GGG ACC ACC AC). pGEX–KGG3-4 was generated by PCR using pGEX–KGG2 as a template and the following primers: KGG3-4 forward d(AGA CAA AGG TGG CTT CAA AGG...

Ngày tải lên: 15/02/2014, 01:20

... DNA was isolated with the GFX TM Micro Plas- mid Prep Kit (Amersham Pharmacia Biotech, Piscataway, NJ, USA), and the resulting dsDNA was mixed with 8 lL BigDye TM master mix (BigDye TM Terminator ... from the DSC curve. The enthalpy change (DH cal ) of each protein was calculated by integra- tion of the curve covering area (T m was taken as the curve peak point) using origin s...

Ngày tải lên: 20/02/2014, 01:20

... feedback mechan- ism also helps to eliminate cases in which the sys- tem is unable to accurately track the pitch of an utterance. In these cases, the utterance will be marked unacceptable and the ... recording on the part of the speaker, this is the approach the ModelTalker Syn- thesizer has taken. However using smaller units may result in noticeable auditory glitches at...

Ngày tải lên: 20/02/2014, 09:20

... (Hearst, 1992; Nakamura and Nagao, 1988) and natural lan- guage understanding in general. Among the above applications, natural language un- derstanding (NLU) is the most challenging from a sci- entific ... dictionary, but decreased the accuracy. However, by combining both resources, the accuracy was noticeably improved, and the coverage was comparable with that for the Nichi- ga...

Ngày tải lên: 20/02/2014, 18:20

... hnRNP A1 C UAGACUAGA 5428–5437 ESE2 SC35, SRp40 CCAGUAGAUCCUAGACUAGA 5418–5437 A5 ESE GAR ASF ⁄ SF2, SRp40 GAAGAAGCGGAGACAGCGACGAAGA 5558–5582 [7] A7 ESS3 hnRNP A1 , hnRNP E1 ⁄ E2 AGAUCCAUUCGAUUAG unknown 8047–8062 ... 32] ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950 ESE3 ASF ⁄ SF2 GAAGAAGAA 8016–8025 hnRNP A1 UAGAAGAAGAA 8018–8025 HIV-1 alternative splicing regulation J. Tazi et al....

Ngày tải lên: 06/03/2014, 09:22

... removal of the harmonic restraints on the backbone atoms around the binding pocket. Manual placement of aI225–aM231, as well as visualization of the results of energy minimization, was performed using ... the interacting helical faces of subunits a and c from the I. tartaricus ATP synthase has been mapped. According to these data, the essential stator arginine (aR226) is...

Ngày tải lên: 16/03/2014, 06:20

... MWTs in the source and target language. Second, we validate candidate translations using a set of terms collected from the web, rather than using empirical evidence from the web as a whole. ... in the litera- ture (Baldwin and Tanaka (2004), Cao and Li, Langkilde and Knight (1998)). 3.1 Translation Candidates Generation Translation candidates are generated using a...

Ngày tải lên: 17/03/2014, 22:20

... i.e. P (w |a) = C(w, a) /C (a) . Because this may be an overestimate (w may appear in a sentence contain- ing a due to causes other than a) , and also because of data sparsity, the quantity τ(w) may sometimes result ... are classified based on the unordered words contained in the sentence. This baseline shows the performance of a standard text- classification approach to the p...

Ngày tải lên: 23/03/2014, 18:20