Báo cáo khoa học: "Does Size Matter – How Much Data is Required to Train a REG Algorithm?" potx

Báo cáo khoa học: "Does Size Matter – How Much Data is Required to Train a REG Algorithm?" potx

Báo cáo khoa học: "Does Size Matter – How Much Data is Required to Train a REG Algorithm?" potx

... Dutch data. The D-TUNA data are cleaner than the TUNA data (Theune et al., 2010), so the risk of “bad” training data will be smaller, which may lead to more consistent results across training ... different from those obtained using a much larger training set. Domain complexity appears to be a factor in how much training data is needed: using Dice as an evaluation metr...

Ngày tải lên: 07/03/2014, 22:20

5 355 0
Báo cáo khoa học: "DESIGNING ILLUSTRATED TEXTS: HOW LANGUAGE PRODUCTION IS INFLUENCED BY GRAPHICS GENERATION" pptx

Báo cáo khoa học: "DESIGNING ILLUSTRATED TEXTS: HOW LANGUAGE PRODUCTION IS INFLUENCED BY GRAPHICS GENERATION" pptx

... It is an important goal of this research not simply to merge the verbalization results of a natural language generator and the visualization results of a knowledge-based graphics generator, ... Stuhlsatzenhausweg 3, 6600 Saarbrficken 11, Germany E-mail: {wahlster, andre, graf, rist)@dfki.uni-sb.de ABSTRACT Multimodal interfaces combining, e.g., natural language and graphics t...

Ngày tải lên: 01/04/2014, 00:20

7 168 0
Báo cáo khoa học: Phosphorylation-dependent binding of human transcription factor MOK2 to lamin A⁄C pot

Báo cáo khoa học: Phosphorylation-dependent binding of human transcription factor MOK2 to lamin A⁄C pot

... those LexA NH 2 Finger Bait Prey β β –Gal – pGAD–GH pLex–hsMOK2 NH 2 LexA Finger – pLexA LexA pGAD–JLP ( 1–1 41) + /– pGAD–GH pLex–NH 2 LexA NH 2 – pGAD–GH pLex–Finger LexA Finger + /– pLex–NH 2 LexA NH 2 pGAD–JLP ( 1–1 41) +++ pLex–hsMOK2 pGAD–JLP ... phosphory- lated and then released from lamin A ⁄ C. This regula- tion may take place following activation of kinases...

Ngày tải lên: 07/03/2014, 01:20

11 378 0
Báo cáo khoa học: Multi-tasking of nonstructural gene products is required for bean yellow dwarf geminivirus transcriptional regulation potx

Báo cáo khoa học: Multi-tasking of nonstructural gene products is required for bean yellow dwarf geminivirus transcriptional regulation potx

... were repeated in triplicate. Northern blot analysis Plant total RNA was isolated by the method of Chomczyn- ski & Sacchi, and 10 lg of purified total RNA per lane was loaded onto a 1% agarose denaturing ... of banana bunchy top virus DNA-1 to 6 in transgenic tobacco and banana cells. J Gen Virol 79, 230 1–2 311. 52 Huang Z, Andrianov VM, Han Y & Howell SH (2001) Identification of...

Ngày tải lên: 16/03/2014, 13:20

13 411 0
Báo cáo khoa học: Combining theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a-induced early antiviral signalling pdf

Báo cáo khoa học: Combining theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a-induced early antiviral signalling pdf

... interferon -a and interferon-c through induced synthesis of one subunit of the transcription factor ISGF3. EMBO J 9, 110 5–1 111. 10 Tamada Y, Nakao K, Nagayama Y, Nakata K, Ichikawa T, Kawamata Y, Ishikawa ... Nakao K, Nakata K, Yamashita M, Tamada Y, Hamasaki K, Ishikawa H, Kato Y, Eguchi K & Ishii N (1999) p48 (ISGF-3c) is involved in interferon -a- induced suppression of hepatit...

Ngày tải lên: 23/03/2014, 03:20

14 432 0
Báo cáo khoa học: Activation of p21-activated kinase 1 is required for lysophosphatidic acid-induced focal adhesion kinase phosphorylation and cell motility in human melanoma A2058 cells potx

Báo cáo khoa học: Activation of p21-activated kinase 1 is required for lysophosphatidic acid-induced focal adhesion kinase phosphorylation and cell motility in human melanoma A2058 cells potx

... PAK1 activity was accessed with MBP as a substrate after immunoprecipitation with an antibody raised against PAK1. Activation of PAK1 by LPA was maximalat5minincubationwith7.8-foldincrease,and returned ... clearly demonstrated that PAK1 activation was required for FAK phosphorylation to increase cell motility by LPA in A2 058 human melanoma cells. Activation of PAK is regulated intra...

Ngày tải lên: 30/03/2014, 13:20

9 305 0
Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc

Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc

... RT-PCR GAPDH GAG CTG AAC GGG AAG CTC ACT GG GTG AGG GAG ATG CTC AGT GTT GG 429 RT-PCR CaN AGTAACAATTTTCAGTGCTCCAAAC AATATACGGTTCATGGCAATACTGT 205 RT-PCR CaMKII CTACCCCGGCGCTGGAGTCAAC TCAGATGTTTTGCCACAAAGAGGTGCCTCCT ... Babraham Hall, Barbraham, Cambridge, UK) and CaN activity was meas- ured according to the manufacturer’s instructions. Total CaN activity is expressed as a percentage vs....

Ngày tải lên: 19/02/2014, 07:20

13 578 0
Báo cáo khoa học: Does different orientation of the methoxy groups of ubiquinone-10 in the reaction centre of Rhodobacter sphaeroides cause different binding at QA and QB? potx

Báo cáo khoa học: Does different orientation of the methoxy groups of ubiquinone-10 in the reaction centre of Rhodobacter sphaeroides cause different binding at QA and QB? potx

... recombination kinetics at 865 nm after photobleaching of the primary donor to a sum of two exponentials: A ¼ A 1 exp(–k 1 t 1 ) +A 2 exp(–k 2 t 2 ). Upon normalization of the amplitudes A 1 (fast Q A – decay) ... vibrations may also contribute to these bands. However, the clear shifts show that the (ring-)C-O vibration is the dominating mode, as expected by normal mode an...

Ngày tải lên: 23/03/2014, 21:20

7 359 0
Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"

Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"

... medical emergency responses and teams. A traditional cardiac arrest ('code blue') team is comprised of a cardiology fellow and coronary care nurse, as well as an intensive care fellow and ... staff should be available on a 24-hour basis to assess and treat acutely ill hospital patients. Utilization of a MET system has been associated with a reduc- tion in all-cause hos...

Ngày tải lên: 25/10/2012, 10:45

4 541 0
Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

... An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity Stephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy Mogridge Department of Laboratory ... sufficient to induce apoptosis. It is unclear why the mutant is defec- tive at causing pyroptosis, but it is presumably because LF-K518E ⁄ E682G has a diminished capacity to cleave a su...

Ngày tải lên: 16/02/2014, 09:20

9 579 0
w