Báo cáo khoa học: Conformational studies of a hyperthermostable enzyme potx
Báo cáo khoa học: Conformational studies of a hyperthermostable enzyme potx
... conformation. The aniso- tropy of native LamA decays slower relative to that after heat and chemical treatment. Data analysis revealed two rotational correlation times at / 1 ¼ 260 ps and / 2 ¼ ... rigidity, compact- ness, fluorophore dynamics and rotational motion of the protein [6,7]. Even in the absence of structural data, valuable information about the local and global dynamics of...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khóa học: Conformational changes of b-lactoglobulin in sodium bis(2-ethylhexyl) sulfosuccinate reverse micelles A fluorescence and CD study docx
... measurements were performed until a maximum of 10 4 counts was obtained. NATA lifetime (s F ¼ 2.85 ± 0.05 ns) was used as a standard to check the apparatus response on a daily basis. Data analysis ... 3817–3822. 21. Barteri, M., Gaudiano, M.C., Rotella, S., Benagiano, G. & Pala, A. (2000) Effect of pH on the structure and aggregation of human glycodelin A. A comparison with...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Conformational properties of bacterial DnaK and yeast mitochondrial Hsp70 Role of the divergent C-terminal a-helical subdomain pdf
... 5¢-CCCGCCATGGGTAAAATAATTGGTA TCG-3¢ and 5¢-CCCGGATCCAAGCTTTTACTGCTTAG TTTCACCAGA-3¢. The PCR fragments were cloned into the bacterial expression vector pTrc9 9A (Amersham Phar- macia Biotech, Piscataway, NJ) following ... structure and specificity F. Moro et al. Conformational properties of bacterial DnaK and yeast mitochondrial Hsp70 Role of the divergent C-terminal a- helical subdoma...
Ngày tải lên: 16/03/2014, 22:20
Báo cáo khoa học: Structural studies of thymidine kinases from Bacillus anthracis and Bacillus cereus provide insights into quaternary structure and conformational changes upon substrate binding pot
... conserved among plants, mammals and Gram-positive bacteria including Myco- bacteria, but replaced with glutamic acid in Gram- negative bacteria. There are also salt bridges between Glu136 and Arg184 ... the enzyme are to main-chain atoms such that O2 and N3 form hydrogen bonds to main-chain atoms of residues in the lasso-domain and O4 to main-chain atoms in the a ⁄ b-domain. The methyl...
Ngày tải lên: 23/03/2014, 09:21
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and Genetics Unit, Jawaharlal ... Maithal K, Ravindra G, Balaram H & Balaram P (2002) Inhibition of Plasmodium falciparum triosephos- phate isomerase by chemical modification of an inter- face cysteine: electrospra...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... M, Hasegawa K, Horita C & Akera S (1999) A new matrix protein family related to the nacreous layer formation of Pinctada fucata. FEBS Lett 462, 225–229. 5 Kono M, Hayashi N & Samata T ... structure–function relationship analysis of Prismalin–14 from the prismatic layer of the Japanese pearl oyster, Pinctada fucata. FEBS J 274, 5158–5166. 9 Murayama E, Takagi Y, Ohira T, Davis...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx
... Q81N- fwd:5¢-TGGGCCATGCCCTTT AACAGTTATGTCACG CTG-3¢. Q81N-rev:5¢-CAGCGTGACATAACT GTTAAA GGGCATGGCCCA-3¢. R105H-fwd:5¢-GCTAAAAATAA TGGAGC ACTCCATTTTTAGCGCTCGC-3¢ . R105H- rev:5¢-GCGAGCGCTAAAAATGGAG TGCTCCATTAT TTTTAGC-3¢. ... R105H- rev:5¢-GCGAGCGCTAAAAATGGAG TGCTCCATTAT TTTTAGC-3¢. R105K-fwd:5¢-GCTAAAAATAATGGAG AAATCCATTTTTAGCGCTCGC-3¢. R105K-rev:5¢-GCG AGCGCTAAAAATGGA TTTCTCCATTATTTTTAGC-3¢...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... absorption bands. Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of verdoheme ... T, Zhang X, Sun D, Sato M, Sasahara M, Kayama T, Ikeda-Saito M & Yoshida T (2000) Histidine 20, the crucial proximal axial heme ligand of bacterial heme oxygenase Hmu O f...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx
... List of PCR primers. Restriction sites are underlined. No Sequence 1 GCTTTTAAAGTTGACTTCAAAG 2 CTTTGAAGTCAACTTTAAAAGC 3 CTA CCATGGCACCTCCTTCTTCTTTCTCAA 4 GCT GTCGACTTATTTAGTGCATGCTTTATAAACAA 5 CTA CCATGGCCCCCATCTCTTTTAGTCAT 6 ... and the mean values are drawn. AB Fig. 8. Cleavage of plasmid, dsDNA and ssDNA. (A) 14 nM VcEndA incubated at 23 °C for 5 min with plasmid (lane 2), dsDNA (lane 4...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf
... 25% of the accessible surface area of a monomer contributes to Ll PDH dimer formation. Whereas LlPDH and OaPDH have a buried surface area of 5500 A ˚ 2 , TbPDH has a larger interface surface area ... suite: programs for protein crystallo- graphy. Acta Crystallogr D Biol Crystallogr 50, 760–763. 28 Navaza J (1994) Amore – an automated package for molecular replacement. Acta Cry...
Ngày tải lên: 19/02/2014, 05:20