Báo cáo khoa học: Structural evidence for a constant c11 ring stoichiometry in the sodium F-ATP synthase doc
... nontreated c ring (–) and the c ring incubated at 95 °C for 5 min. The gel was stained with silver. A molecular mass stand- ard is shown. T. Meier et al. Structural evidence for a constant c 11 ring ... that can be packed into the ring. These data are fully compatible with the recent finding that the stoichiometry of the subunit III cylinder within the ATP...
Ngày tải lên: 07/03/2014, 21:20
... thioester acyl–enzyme intermediate. Biochemistry 49, 341–346. 3 Fukuda A, Matsuyama S, Hara T, Nakayama J, Nagasawa H & Tokuda H (2002) Aminoacylation of the N-terminal cysteine is essential for ... methicillin- sensitive strain MSSA476 (C). Asterisks in (A) are signals 2-Da smaller than the triacylated peptides filled with saturated fatty acids. Triacylated lipoproteins in S. a...
Ngày tải lên: 06/03/2014, 01:20
... CYIIB–TBP–promoter complex formation in the presence of GAL4-VP16, different rate constants were obtained: 4.26 min )1 for AdML and 2.32 min )1 for AdE4, indicating that the acceleration of the complex formation ... (1.14–0.95 for AdML and 1.14–0.98 for AdE4). As the conformational change of TFIIB probably involves a hinge motion of the domain linker, both the relative...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: No evidence for a role in signal-transduction of Na+/K+-ATPase interaction with putative endogenous ouabain potx
... and the results interpreted accordingly. Fig. 1. Ouabain a nities to rat Na + /K + -ATPase isoforms and actual ouabain or OLF concentrations. The guresummarizesthehugevari- ation in ouabain a nities ... mimic ouabain with respect to the cascade in rat cardiac myocytes [9]. In rat renal cells [8] on the other hand, ouabain interaction with a minor fraction of the Na + /K + -...
Ngày tải lên: 23/03/2014, 17:21
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf
... and a C-terminal flavopro- tein or reductase domain that binds NADPH, FAD and FMN. The two domains are separated by a CaM-binding motif. During catalysis, NADPH- derived electrons transfer into the ... for equilibrium A Common structural features in dual-flavin enzymes may determine their set points for K eq A. Among these are complementary charge pairing interactions that ar...
Ngày tải lên: 18/02/2014, 11:20
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx
... advice and assis- tance during the two-hybrid screen. We are grateful to Nicola Minshall and Nancy Standart for the tethering assay constructs, and to Marvin Wickens and Labib Rouhana for the gifts ... However, the RRM-containing central domain of hRbm9 (amino acids 48–269) and amino acids 269–350 of hRbm9 are not able to mediate the binding. These data suggest that a domain s...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: First evidence of catalytic mediation by phenolic compounds in the laccase-induced oxidation of lignin models ppt
... quite reasonable to argue that natural mediators may participate in the laccase-catalyzed oxidation of nonphenolic lignin subunits in those micro-organisms that only rely on laccase for their ligninolitic ... delocalization of the negative charge of the anion onto the adjacent quinoid ring (see Fig. 2). Analogously, delocalization of the un- paired electron of the correspo...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc
... 5¢-TATATCATTCA GGATTATTTG TATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAG ATACAAATAATCCTGAATGA TATAAAAAC-3¢ (reverse). The pET151 HP1287 plasmid was ... present any activity on thiamin degradation. Other enzymes involved in the thiamin pathway A comparative analysis of the thiamin biosynthetic pathway of more than 80 bacterial gen...
Ngày tải lên: 16/03/2014, 00:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ... Ravindra G & Balaram P (2005) Plasmodium falciparum triosephosphate isomerase: new insights into an old enzyme. Pure Appl Chem 77, 281–289. 20 Parthasarathy S, Ravindra G, Balaram H, Balaram...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Structural bases for recognition of Anp32⁄LANP proteins doc
... domain up to a 60 : 1 ratio. The data were evaluated using the origin program package (Micro-Cal Software, Bletchley, UK). Yeast two-hybrid analysis The DNA fragment encoding the murine Anp3 2a ... (1–164 amino acids) was cloned into the pGBKT7 vec- tor (Clontech, Mountain View, CA, USA) for expression as a Gal4 DNA-binding domain fusion protein. This bait was transformed int...
Ngày tải lên: 18/02/2014, 17:20