Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

... low at the beginning of the last larval stadium, but it gradually increased, reaching a peak at the wandering stage late in the last larval stadium. At the prepupal stage, EH activity declined ... clofibrate and harvested at 5, 8 and 14 h post-treatment. The poly (A) -RNA was extracted from the larvae, and 300 ng mRNA of each sample was loaded on a gel. Actin mRNA served as an...
Ngày tải lên : 07/03/2014, 21:20
  • 10
  • 378
  • 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

... (5¢-ATAATGGATAA CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2 sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/ TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGAT CACC-3¢), respectively. The PCR ... three sets of primers: first set, A5 1 (5¢- GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7 (5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢- AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGT...
Ngày tải lên : 21/02/2014, 03:20
  • 11
  • 506
  • 0
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

... ferulic acid, methyl or acetyl groups, and depolymerases. The latter can be classified into lyases (b-elimination) and hydrolases [2]. All hydrolases involved in degradation of pectin are classified as ... members of family 28 of the glycoside hydrolases, including the endopolygalacturonases, exo- polygalacturonases and rhamnogalacturonases [3,4]. Although a handful of endopol...
Ngày tải lên : 20/02/2014, 03:20
  • 10
  • 592
  • 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are available in the Protein Data Bank ... Functional and structural analyses of N-acylsulfonamide- linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan 1 , Bryan D. Smith 2, *, Ronald T. Raines 2,3 an...
Ngày tải lên : 14/02/2014, 22:20
  • 9
  • 626
  • 0
Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

... GCATCAACTTTCAAAAGAT F127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAG R144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATAC I152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCAT N154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGT K31 1A ... AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTT Y55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACT T56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG...
Ngày tải lên : 15/02/2014, 01:20
  • 10
  • 563
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho- ribosyltransferases is examined using saturation muta- genesis, functional analysis, and ... respectively, indicating that Asp137 functions as a catalytic base [12]. However, a tight binding of N7 of the purine base and Asp137 was observed in HPRT in complex with ImmGP,...
Ngày tải lên : 15/02/2014, 01:20
  • 11
  • 770
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

... C-terminal flavopro- tein or reductase domain that binds NADPH, FAD and FMN. The two domains are separated by a CaM-binding motif. During catalysis, NADPH- derived electrons transfer into the FAD and ... attached flavoprotein and heme domains of NOS are also an unusual feature shared by only a handful of prokary- otic CYP proteins [4,8,25]. In comparison, the NOS flavoprotein dom...
Ngày tải lên : 18/02/2014, 11:20
  • 16
  • 639
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx

... Using a combination of experimental and computational approaches, we have shown that H-transfer reactions can occur by ‘deep’ tunnelling and the reaction can be enhanced by local- ized dynamics ... (R,S)-[4,4- 2 H 2 ]-NADPH can be pre- pared in the same manner as (R,S)-[4,4- 2 H 2 ]-NADH. However, an NADPH-specific enzyme such as PETNR must be used in place of MR. NADH 4 and NA...
Ngày tải lên : 18/02/2014, 11:20
  • 12
  • 595
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

... subunits, PsaA and PsaB, via a loop that also plays a role in the attachment of PsaC [12]. PsaC, PsaD and PsaE are located at the cytosolic site (Fig. 1A) [2,7,13–16]. PsaC carries the terminal F A and ... loop that is maintained by a small two-stranded antiparallel b sheet at the top (Fig. 1B). The NADP + -binding domain includes resi- dues 139–303 and consists of a c...
Ngày tải lên : 18/02/2014, 11:20
  • 17
  • 634
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... enterica Typhimurum strain IFO12529 genomic DNA as the template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing ... S, Khachatr- yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotoga maritima stationary phase survival protein SurE: a novel acid phos...
Ngày tải lên : 18/02/2014, 14:20
  • 10
  • 553
  • 0

Xem thêm