0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

... chromatin association of ATR (ataxia telangiecta-sia-mutated and Rad3-related) in vitro via ATR inter-acting protein [4,22,23]. Rad17 and Rad9 complexes(Rad17–RFC2–5 and Rad9–Rad1–Hus1) play a ... (AtRPA7 0a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A. thali-ana are already available [26]. We were able to obtainone T-DNA insertion line each for AtRPA7 0a and AtRPA70b ... (AGAATTCTGAGGTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACTATCAGCAGAAGCAATGTGGTGATA) and 70b R2(TTACTGAGATGTCTTGTTCTTGGAAATGT) primersfor atrpa70b. As a control, A. thaliana putative 40S ribo-somal protein S16 (At5g18380)...
  • 12
  • 588
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "TWO TYPES OF PLANNING IN LANGUAGE GENERATION" pot

... planning and realization and is characterized by a two- way communication at the realizer's decision points. The advantages are: First, it allows the separation of planning and re- alization ... Abstract As our understanding of natural language gener- ation has increased, a number of tasks have been separated from realization and put together un- der the heading atext planning I. ... been advanced) 3 Planning in PAULINE 3.1 Program Architecture, Input and Opinions The user provides PAULINE with input topics and a set of pragmatic goals, which activate a number of intermediate...
  • 8
  • 433
  • 0
Báo cáo khoa học: Light-harvesting complex II protein CP29 binds to photosystem I of Chlamydomonas reinhardtii under State 2 conditions doc

Báo cáo khoa học: Light-harvesting complex II protein CP29 binds to photosystem I of Chlamydomonas reinhardtii under State 2 conditions doc

... Each of these subpopulations was extracted fromthe total data set and treated de novo, gaining initial two- dimensional class averages and then iterative refinement fol-lowed in order to obtain ... not contain phosphate and complimentaryions containing phosphate and satellite signals with the neutral loss of phosphoric acid (b and y ions marked with the asterisk). (A) Frag-mentation spectrum ... studies on a mutant of Chlamydomonas gen-erated by dsRNA antisense technology having an unde-tectable level of CP29 (A. Kanno and J. Minagawa,unpublished observations). We found that althoughthis...
  • 10
  • 318
  • 0
Báo cáo khoa học: by nucleotide affinity cleavage: a distinct nucleotide specificity of the C-terminal ATP-binding site potx

Báo cáo khoa học: by nucleotide affinity cleavage: a distinct nucleotide specificity of the C-terminal ATP-binding site potx

... C-terminal nucleotide binding domain of Hsp90.Binding of Hsp90 to the commercially available and ‘lab-made’ ATP-Sepharose resins was analyzed as described in Materials and Methods.Figures are ... C-terminal nucleotide-binding domain in theabsence of GA, and induced ATP-binding and the appear-ance of the specific N46 fragment (Fig. 7). Fluoresceinisothiocyanate behaved similarly to OMFP and ... specificities of Hsp9 0a and Hsp90b (data not shown).As an additional proof, we analyzed the competition of these nucleotides with ATP–Sepharose binding, in theabsence (N- and C-terminal binding), and in...
  • 8
  • 392
  • 0
Báo cáo khoa học: Two CCAAT/enhancer binding protein sites in the cytochrome P4503A1 locus Potencial role in the glucocorticoid response ppt

Báo cáo khoa học: Two CCAAT/enhancer binding protein sites in the cytochrome P4503A1 locus Potencial role in the glucocorticoid response ppt

... 5¢-GGAGAAAGTCCGTCTATGGTGGTGTGCAGATGACACAGTTTTGGC-3¢; site 3A1 -600: 5¢-GCCTCTGCTCTGTAAGTGCAGGACCGTAGAGGTCTATTACTTATG-3¢.mRNA analysisTotal liver RNA was extracted by a modification of the ... Ogino, M., Nagata, K., Miyata, M. & Yamazoe, Y. (1999)Hepatocyte nuclear factor 4-mediated activation of rat CYP 3A1 gene and its modes of modulation by apolipoprotein AI regulatory protein ... time-course variation of the relative concentrations of C/EBPa mRNAandproteinwasmonitoredintheratliver. In parallel we also followed the accumulation of theCYP 3A1 mRNA, upon addition of dexamethasone(Fig....
  • 9
  • 425
  • 0
Báo cáo khoa học: Human papillomavirus 16 E7 protein inhibits interferon-c-mediated enhancement of keratinocyte antigen processing and T-cell lysis docx

Báo cáo khoa học: Human papillomavirus 16 E7 protein inhibits interferon-c-mediated enhancement of keratinocyte antigen processing and T-cell lysis docx

... Queensland Diamantina Institute, Princess Alexandra Hospital, Brisbane, Qld, AustraliaIntroductionPersistent infection of the cervical epithelium with one of a range of oncogenic human papillomaviruses(HPVs) ... dimethylase, for-ward, 5¢-GGA GGG CCC ATC AGT TTA AT-3¢; rRNAadenine dimethylase, reverse, 5¢-AAA CAA TTG CAT TGCATA GTGC-3¢. The data were analyzed with rotor-gene 6000.Statistical analysisAll experimental ... infec-tion. It may also explain why local administration of supraphysiological concentrations of IFNs can contrib-ute to the clearance of HPV-associated genital warts[36]. Administration of...
  • 9
  • 352
  • 0
Báo cáo khoa học: Kinetic deuterium isotope effects for 7-alkoxycoumarin O-dealkylation reactions catalyzed by human cytochromes P450 and in liver microsomes Rate-limiting C-H bond breaking in cytochrome P450 1A2 substrate oxidation pdf

Báo cáo khoa học: Kinetic deuterium isotope effects for 7-alkoxycoumarin O-dealkylation reactions catalyzed by human cytochromes P450 and in liver microsomes Rate-limiting C-H bond breaking in cytochrome P450 1A2 substrate oxidation pdf

... utilizedas probes because of their spectral and fluorescentproperties. Among these are the coumarins [6,7] and resorufins [7,8]. Coumarin and several derivatives areKeywordsalkoxycoumarins; coumarins; ... coumarin have an advantage in that there is no issue with pro-chirality. However, withboth d17-OEt coumarin and d27-OMe coumarin someperturbation can occur because of a geminal secondarykinetic ... analysis with Graph-Pad prism software (Graph-Pad,San Diego, CA, USA). See Supplementary material fortypical chromatograms.Intermolecular competitive and intramolecular noncom-petitive kinetic...
  • 9
  • 314
  • 0
Báo cáo khoa học: Two different types of hepcidins from the Japanese flounder Paralichthys olivaceus ppt

Báo cáo khoa học: Two different types of hepcidins from the Japanese flounder Paralichthys olivaceus ppt

... in HIB containing 2% (w ⁄ v) NaCl(2HIB) at 25 °C. S. iniae (strain TUMST1 isolated fromJapanese flounder in Japan) and L. garvieae (strain SA8201isolated from yellowtail S. quinqueradiata in ... (strainMZ8901 isolated from Japanese flounder in Japan) wasgrown in HIB at 25 ° C. P. damselae ssp. piscicida (strainP97-008 isolated from yellowtail Seriola quinqueradiata in Japan) was grown ... that fish hepci-din has higher anitimicrobial activity against some fishpathogenic bacteria compared to that of human. Hep-JF1pep has no antibacterial activity against the bac-teria used in...
  • 8
  • 310
  • 0
Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

... Two novel variants of human medium chain acyl-CoAdehydrogenase (MCAD)K364R, a folding mutation, and R256T, a catalytic-site mutationresulting in a well-folded but totally inactive protein Linda ... normalenzyme. Eur J Biochem 246, 548–556.15 Ikeda Y, Okamura-Ikeda K & Tanaka K (1985) Purifi-cation and characterization of short-chain, medium-chain, and long-chain acyl-CoA dehydrogenases ... I,Strauss A et al. (1997) Biochemical characterization of purified, human recombinant Lys304?Glu medium-chainacyl-CoA dehydrogenase containing the common dis-ease-causing mutation and comparison...
  • 9
  • 533
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "TWO KINDS OF METONYMY" pdf

... flights)that serve dinner" offers any constraint on the class AIRCRAFT: in other words, that being a particular type of aircraft and being used by a flight that serves dinner are correlated in ... its range. Since every flight in ATIS is on an airline, AIRLINE -OF is a total relation, and AIRLINE is its range, so a referential metonymy is clearly vacuous in this case. In contrast, the ... the standpoint of the predicate, one can think of the coercion relation as extending the given argument place of the predicate to take an argument of a different type. From the standpoint of...
  • 8
  • 464
  • 1

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam