Báo cáo khoa học: Interaction of synthetic peptides corresponding to hepatitis G virus (HGV/GBV-C) E2 structural protein with phospholipid vesicles doc

... 2005) doi:10.1111/j.1742-4658.2005.04666.x The interaction with phospholipid bilayers of two synthetic peptides with sequences corresponding to a segment next to the native N-terminus and an internal region of the E2 structural hepatitis ... pI (6.14) of the parent E2( 279–298) peptide. Binding of E2 peptides to model membranes Lipid interaction of t...

Ngày tải lên: 07/03/2014, 17:20

... inhibitory action of peptides 5 and 8 on the b 1 isoform was found to be significantly higher (P < 0.05) compared to the whole PKI55 protein. Effects of selected peptides on PMN inflammatory ... working strength stock solution with the following composition: NaCl 40 g L )1 ; KCl 1.875 g L )1 ;Na 2 HPO 4 .2H 2 O 0.6 g L )1 ;KH 2 PO 4 0.125 g L )1 ; NaHCO 3 1.25 g L )1 ; a...

Ngày tải lên: 07/03/2014, 05:20

... CGG GGT CTC CCA- TG GCA ATG AGG GCT GCG GGT G- 3¢; HCV-1b Core+1/S sense, 5¢-ATC CGG GGT CTC CCATG GCA ATG AGG GCC TGG GGT G- 3¢; HCV-1a Core+1/S antisense, 5¢-AT CCG GGT CTC GGTACC TTA TCA CGC ... TTA TCA CGC CGT C TT CCA GAA C-3¢; and HCV-1b Core+1/S antisense, 5¢-AT CCG GGT CTC GGTACC CTA GGG GGG CGCC G A CG-3¢ (italic indicates BsaIsites; underlined sequences correspond to Nco I sit...

Ngày tải lên: 15/03/2014, 09:20

... processing of GPV in CHO and K562 cells c otransfected with GPV and GPIb-IX. (A) CHO cell s stably transfectedwithGPV,GPIba,GPIbßandGPIXwereanalysedforsurfaceexpression of GPV b y flow cytometry. ... soluble form of GPV The CHO/GPV cell line transfected with full length GPV lacked surface expression of GPV as m easured by flow cytometry (Fig. 1A), despite selection of a strongly e...

Ngày tải lên: 23/03/2014, 13:20

... actin [5]. Aggregation was followed by light scattering, measured at 560 nm, again using the Hitachi F-3000 fluorescence spectrophotometer. Ultracentrifugation was also used to follow aggregation of partially ... l M ) was cooled to 25 °C, and aggregation was initiated by the addition of KCl and MgCl 2 up to 50 m M and 2 m M , respectively. The increase of ionic strength promotes a...

Ngày tải lên: 20/02/2014, 23:20

... calorimetry of (A) ADP, (B) AMP and (C) GTP binding to GlnK. Fig. S2. TnrA C-terminal truncations. Fig. S3. Crosslinking analysis of truncated TnrA proteins. Doc. S1. Purification of His 6 -tagged TnrA proteins, purification ... negative regulator of glnA and gltAB , encoding the ammonium assimilatory enzymes gluta- mine synthetase (GS) and glutamate synthase, respec- tively [6–8]. T...

Ngày tải lên: 06/03/2014, 00:21

... under- standing of the detailed mechanism of protein aggrega- tion and the resulting cellular toxicity should lead to rational drug design for this type of disease. Protein aggregation can result ... b 2 -microglobulin or prion fragments, exert toxicity by forming pores in membranes, initiating a cascade of detrimental events for the cell. Interaction of granular aggregates...

Ngày tải lên: 07/03/2014, 17:20

... site is underlined. E.CP sense E.CP anti CCG CATATGG GAATTC ATGATGGCGAAAAGGCTTTCG CCG CATATGG GAATTC GTTGTTCAGGGCTGAGGC Primers for amplification of the CP gene. The EcoRI site is indicated in bold ... Sequence (5¢fi3¢) Description MP sense MP anti CCG GCTAGCG GAATTC ATGATGGTAATGCAAGCTCAGCATACT CCGG GAATTC GGAGGAGGACATAGCCCT Primers for amplification of the MP gene. The EcoRI site is indicat...

Ngày tải lên: 15/03/2014, 00:20

... 27 5¢-TGGTGTGTGTGGGGTGGTTGGTG-3¢ GT -G1 23 5¢-TGGGGTGTGTGGGGTGGTTGGTG-3¢ GT -G2 23 5¢-TGGGGTGTGTGGGGGGGTTGGTG-3¢ GT -G3 23 5¢-TGGTTGGGGTGGGGGGGGGGGTG-3¢ GT -G4 23 B. Scaggiante et al. GT oligonucleotides, ... oligomer 119 76 47 29 123456 – GT GT -G1 GT -G2 GT -G3 GT -G4 12 3 4 5 kDa 119 76 47 29 A B Fig. 3. Binding of the G- rich GT oligomers to total nuclear proteins. (A) Competitio...

Ngày tải lên: 16/03/2014, 13:20

... determined for the interaction of GA and c-CD [22,26]. Analyses using NMR and DLS showed the aggrega- ted property of GA. Aggregation should be due to the hydrophobic property of GA, which is also ... unbound GA is in a water-soluble aggregate that is dispersed when it forms a complex with c-CD. Dynamic light scattering showed that the average diameter of unbound GA is > 30 n...

Ngày tải lên: 16/03/2014, 14:20