Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

... 2455 The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding Jonathan A. R. Worrall, ... form, albeit with the axial ligand still intact, with the main- and side-chain atoms of K99 flipped up and away from the heme...

Ngày tải lên: 07/03/2014, 17:20

15 510 0
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

... siRNA: sense, 5¢-AGGACUUCUUGAAAGGCAA CAUUAAAG-3¢, antisense, 3¢-UAUCCUGAAGAACUU UCCGUUGUAAUU-5¢; scrambled HO-2 siRNA: sense, 5¢-UAUAAGAGUCAGUACACAUCAUGGAAG-3¢,anti- sense, 3¢-UAAUAUUCUCAGUCAUGUGUAGUACCU-5¢. Another ... Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced b...

Ngày tải lên: 19/02/2014, 05:20

14 488 0
Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx

Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx

... purification ensured that the recombinant proteins have the same number of amino acids as the native elongation factors. Activity assays The concentration of EF-Tu active in binding guanine nucleotides, ... density is caused by the binding of a deacylated tRNA to the ribosome rather than by a change in the synthesis of (p)ppGpp. Deacylated tRNA has a high co...

Ngày tải lên: 21/02/2014, 00:20

12 502 0
Báo cáo khoa học: Protective effect of dietary curcumin and capsaicin on induced oxidation of low-density lipoprotein, iron-induced hepatotoxicity and carrageenan-induced inflammation in experimental rats ppt

Báo cáo khoa học: Protective effect of dietary curcumin and capsaicin on induced oxidation of low-density lipoprotein, iron-induced hepatotoxicity and carrageenan-induced inflammation in experimental rats ppt

... of plasma alanine aminotransferase (AlAT), aspartate aminotransferase (AsAT) and LDH was assessed. The present study also investigates the anti -in ammatory property of curcu- min and capsaicin ... curcumin, capsaicin and their combination on carrageenan induced in ammation To examine the postlocal anti -in ammatory potential of the combination of spice principles curc...

Ngày tải lên: 08/03/2014, 08:20

10 498 3
Báo cáo y học: "Different effect of exercise on left ventricular diastolic time and interventricular dyssynchrony in heart failure patients with and without left bundle branch block"

Báo cáo y học: "Different effect of exercise on left ventricular diastolic time and interventricular dyssynchrony in heart failure patients with and without left bundle branch block"

... comparison of the indi- vidually observed and predicted time values and for comparison of within-group changes a repeated measures analysis of variance was used. If analysis of variance showed an ... patients had a normal left ventricular cavity size and baseline ejection fraction as evaluated by radionuclide angiography. Coronary artery disease was excluded by...

Ngày tải lên: 05/11/2012, 11:32

8 868 1
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 ... Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 9903 10318 415 C. Gijavanekar et al. PCR detection...

Ngày tải lên: 14/02/2014, 19:20

12 796 0
Tài liệu Báo cáo khoa học: Purified RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf

Tài liệu Báo cáo khoa học: Purified RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf

... cellular retinaldehyde-binding protein. After 2 h of incuba- tion at 37 °C in the dark, the generated retinoids were extracted with 300 lL of methanol and 300 lL of hexane and analyzed by normal-phase ... (A) The lipid amount in each flotation fraction was quantified by scintillation counting of [ 14 C]PC and expressed as a percentage of the total amount of...

Ngày tải lên: 18/02/2014, 08:20

11 587 0
Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"

Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"

... communicated by the switchboard operators through the hospital loudspeakers and paging system, and a detailed log of all calls is maintained. Criteria for medical emergency team activation Calling ... this to aspects of nursing and medical daily routine. Materials and methods The hospital Austin Health is a university-affiliated teaching hospital with three hospital...

Ngày tải lên: 25/10/2012, 10:45

4 541 0
Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt

Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt

... interactions of tau and Fyn may play an important role in regulating the cellular localization of Fyn and tau. Results Tau interacts with Fyn-SH2 Because tau contains tyrosines that could be targeted by ... also an increase in the amount of DRM-associated tau isolated from wild-type neurons (Fig. 5A) . In contrast, pervanadate did not appear to induce any change in...

Ngày tải lên: 14/02/2014, 14:20

11 629 0
Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

... sites are located in the concave face of the protein near regions of invariant Trp and Asn arrays. The major binding site spans ARM repeats 2, 3 and 4 (Fig. 1A) . In the major binding site, the ... NLS in an extended conformation. Database Structural data are available in the protein Data Bank under the accession number 3OQS. Structured digital abstract l CLIC4...

Ngày tải lên: 14/02/2014, 19:20

14 742 0
w