Báo cáo khoa học: The male seahorse synthesizes and secretes a novel C-type lectin into the brood pouch during early pregnancy pdf
Báo cáo khoa học: The male seahorse synthesizes and secretes a novel C-type lectin into the brood pouch during early pregnancy pdf
... FEBS 1235 The male seahorse synthesizes and secretes a novel C-type lectin into the brood pouch during early pregnancy Philippa Melamed, Yangkui Xue, Jia Fe David Poon, Qiang Wu, Huangming Xie, ... resembles a true male pregnancy, as the female deposits her eggs into an enclosed brood pouch on the ventral side of the male s abdomen. This br...
Ngày tải lên: 07/03/2014, 17:20
Tài liệu Báo cáo khoa học: Glycomics-based analysis of chicken red blood cells provides insight into the selectivity of the viral agglutination assay docx
... Chandrasekaran A, Srinivasan A, Raman R, Viswana- than K, Raguram S, Tumpey TM, Sasisekharan V & Sasisekharan R (2008) Glycan topology determines human adaptation of avian H5N1 virus hemagglutinin. Nat ... HA from avian- and human-adapted viruses. Materials and methods PNGase F (glycerol free) was obtained from New England Biolabs (Beverly, MA, USA). Signal 2-AB Labeling Kit, sialid...
Ngày tải lên: 14/02/2014, 19:20
Báo cáo khoa học: Protection of chylomicron remnants from oxidation by incorporation of probucol into the particles enhances their uptake by human macrophages and increases lipid accumulation in the cells ppt
... TGGGTTTTCAACTGGAGAGG 175 SR-B1 GAAACTGCAGCTGAGCCTCT ACCTACTTGGCTCCGGATTT 250 ACAT1 CTACAAGGCAGGCAGTATTGG TAAGCGTCCTGTTCATTTCGT 334 DGAT1 CCTGTGTTGAGGGAGTACCTG GGGCGAAACCAATGTATTTCT 328 ABCA1 AACAGTTTGTGGCCCTTTTG ... (bp) LDLr AGTTGGCTGCGTTAATGTGAC TTCCTCACACTGGCACTTGTA 343 LRP CCCAGGTGTCTACCATCACAC GGGGTTGTAGAGTTCCAGGTC 326 SR -A ATTGCCCTTTACCTCCTCGT ATGAGGTTGGCTTCCATGTC 248 CD36 AGATGCAGCCT...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Submembraneous microtubule cytoskeleton: biochemical and functional interplay of TRP channels with the cytoskeleton pot
... co-localizes and stabilizes microtubules at the cell membrane. Confocal immunofluorescence images of a F11 cell and an enlarged area reveals the accumulation of tubulin (red) at the plasma membrane ... Shinoda M, Nagamine K, Tohnai I, Ueda M & Sugiura Y (2005) Heat and mechanical hyperalgesia in mice model of cancer pain. Pain 117, 19–29. 141 Prevarskaya N, Flourakis M, Bidau...
Ngày tải lên: 30/03/2014, 10:20
Báo cáo khoa học: Detection of nucleolar organizer and mitochondrial DNA insertion regions based on the isochore map of Arabidopsis thaliana ppt
... maps and some features of the five A. thaliana chromosomes Figure 1 shows the z¢ curves for five A. thaliana chro- mosomes. As can be seen clearly, each curve has dra- matic variations, indicating ... less abundant in A. thaliana than in other plants and primarily dominate the centromere regions. Class II transposons and Basho elements are clustered in the pericentromeric domai...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx
... tags 1 Mainly because of the ease with which it is trained even on large data, and also because no other publicly available tagger was able to cope with the amount and ambiguity of the data in reasonable ... hand, and in plural on the other). The casual (lexical, paradigm-external) morpho- logical ambiguity is lexically specific and hence cannot be investigated via paradigmat...
Ngày tải lên: 08/03/2014, 05:20
Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf
... and of branched non-reducing terminal Ara6 motifs: Arafb1 fi 2Arafa1 fi 5 (A rafb1 fi 2Arafa1 fi 3)Arafa1 fi 5Arafa1. About two-thirds of the terminal b-Araf and the penultimate 2 -a- Araf serve as attachment sites ... glycerol-based glycolipids [26]. The branched arabinan chains of the arabinogalactan are attached to the linear galactan backbone. The arabinan consists of an inner...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"
... defined as calculated creatinine clearance less than 50 ml/minute. The parameters needed to calculate the creatinine clearance were always available in both the PB-U and the C-U. In addition to the ... the study. KC was responsible for conceiving the study, data acquisition, analysis of the data, statistical analysis and drafting of the manuscript. BC was responsible for...
Ngày tải lên: 25/10/2012, 10:39
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt
... the noticeable exception of the a- amylase from the bacte- rium Pseudoalteromonas haloplanktis, which displays an additional small (21 kDa) C-terminal domain hav- ing the size of a carbohydrate-binding ... genome databanks. Interestingly, this domain was found in some closely related bacterial species, but mainly in nonvertebrate animals, and invariably connected via a linker t...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: ¨ Induction of Kruppel-like factor 4 by high-density lipoproteins promotes the expression of scavenger receptor class B type I pptx
... 5¢-CCT TCA ATG ACA ACG ACA CCG-3¢ (forward) and 5¢-CCA TGC GAC TTG TCA GGC T-3 ¢ (reverse); glyceraldehyde- 3-phosphate dehydrogenase, 5¢-GAC ATC AAG AAG GTG GTG AAG C-3¢ (forward) and 5¢-GTC CAC CAC CCT ... antibody. RNA extraction and real-time PCR Total RNA was isolated using Trizol Ò reagent (Invitrogen) in accordance with the manufacturer’s protocol. After extraction, 5 lg total...
Ngày tải lên: 18/02/2014, 04:20