Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

... blast and tfasta analysis of the phCoADR revealed a significant level of identity to putative NADH oxidases from hyperthermophiles and bacterial NADH oxidases from mesophilic sources (Fig. 1). Of ... correlates well with the catalytic constant observed for the CoADR reaction. Thermostability and thermoactivity of the CoADR phCoADR is stable for months at both...

Ngày tải lên: 07/03/2014, 17:20

12 420 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... in the Caryophyllaceae, Sambucaceae, Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially useful in agriculture and medicine because of their antiviral properties ... displayed hemagglutination and toxicity toward mice (data not shown), additional efforts to cleanly isolate the isoform were not successful and further characterization was...

Ngày tải lên: 18/02/2014, 16:20

12 763 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

... TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C. The PCR reaction was done as described above. The amplified PCR product was inserted into the ... as an indicator substrate was used. The trans- formants were streaked on the plates and grown for 7 days, and tyrosinase activity was observed on the plates as a brown color...

Ngày tải lên: 19/02/2014, 06:20

14 651 0
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... (degenerate reverse) 55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward) 65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR reverse) 75¢-CGAGCTCACTGCCTCTCAAC-3¢ PsCBL (5¢UTR forward) 85¢-ACTCGTAGC-ACAGAGACAGAG-3¢ ... forward) 25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ PsCIPK (degenerate reverse) 35¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ PsCBL (degenerate...

Ngày tải lên: 19/02/2014, 07:20

19 707 0
Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt

Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt

... follows: HSF 1a forward, 5¢-GAAGCAGCTTGTCCAGTACACCAA-3¢; HSF 1a reverse, 5¢-TTCCAAGAGCTGAACAAACCATTG-3¢; HSF1b forward, 5¢-GAAGCAGCTGGTCCAGTACAC CTC-3¢; HSF1b reverse, 5¢-GGCTGAATAAACCATGC CAGTAGC-3¢; ... Plasmid Cloning kit (Invitrogen) and was used as the PCR template. For 5¢-RACE, the first PCR was performed with the M13 reverse primer (5¢-AGCGGATAACAATTTCACACAGG-3¢)asa sense pr...

Ngày tải lên: 19/02/2014, 12:20

10 539 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

... Gly-Gln, Ala- Ala, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich (Deisenhofen, Germany). Tert. butyloxycar- bonyl ... was subtracted from the total uptake to calculate the carrier-mediated uptake. Inset: Eadie–Hofstee transformation of the specific Gly-Sar uptake data [S, Gly-Sar concentration (m M)...

Ngày tải lên: 07/03/2014, 05:20

10 490 0
Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

... However, the backbone amide and carbonyl of Cys140 form hydro- gen bonds with the backbone carbonyl and amide of Trp123, the side chain of which forms one wall of the active site cavity and the replacement ... than Q14 3A hMnSOD mutants in the paraquat-containing media were selected for fur- ther characterization, and other mutants were discar- ded. Plasmids f...

Ngày tải lên: 07/03/2014, 11:20

9 416 0
Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

... and XhoI ML3p A- chain 5¢- GATATA CATATG TACCGTCGTATTAGCCTTCGTGTCACGGAT -3¢ 5¢- CACAC GAATTC TTATTAAGAAGAAGAAGAACGGTCCCTGCATAC -3¢ NdeI and EcoRI ML3.1p A- chain 5¢- GATATA CATATG TACGAGCGTCTTCGTCTTCGTGTTACGCATC -3¢ 5¢- CACAC GAATTC TTATTAAGAAGAAGAAGAACGGTCCCTGCATAC -3¢ NdeI ... and XhoI ML2p A- chain 5¢- GATATA CATATG TACGAGCGTCTTCGTCTTCGTGTTACGCATC -3¢ 5¢- CACAC CTCGAG TTATTAAGAAGA...

Ngày tải lên: 07/03/2014, 15:20

11 611 0
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

... His290 and Asp260 e merge from the b8 -a8 andb7 -a7 loops, respectively. Another important feature of the catalytic machinery is the so-called oxyanion hole necessary for the stabilization of the oxyan- ion ... 5¢-gcgccaatcctggacgctgacgtcatcgacgcg-3¢ (forward) and 5¢-cgcgtcgatgacgtcagcgtccaggattggcgc-3¢ (reverse). The bases in bold indicate the location of the mu...

Ngày tải lên: 07/03/2014, 16:20

9 584 0
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx

Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx

... identification [5] of two morphologically distinct classes of caveolae at the plasma membrane ) canon- ical caveolae that are open to the extracellular space and caveolae lacking access from the cell ... labelling that was again limited to the HD-caveolae and LD-caveolae and especially the LD-caveolae (not shown). To examine whether the biotin labelling was restricted t...

Ngày tải lên: 16/03/2014, 13:20

12 460 0
w