Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt

Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt

Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt

... expression of A- chain and structural studies Andre ´ L. C. Silva 1 , Leandro S. Goto 1 , Anemari R. Dinarte 2 , Daiane Hansen 3 , Renato A. Moreira 4 , Leila M. Beltramini 1 and Ana P. U. Arau ´ jo 1 1 ... silver- stained. An apparent molecular mass of  59 kDa for ABC Fig. 2. (A) A- chain expression analysis in SDS ⁄ PAGE, 15%. Lane 1, molecular mass marker; lanes 2...

Ngày tải lên: 07/03/2014, 16:20

10 390 0
Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx

Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx

... 1944.1 a 1943.9 57– 72 D7 DDQVDAVTTLLNREYYN 24 02. 3 a 24 01.1 53– 72 D8 A GQVRMCEQN 22 89 .2 a 22 89.1 34– 52 B GQVRMCE 27 46.5 a 27 46.3 34–56 S1 QNLE NS (5 02. 2) 45–48 S2 VYTRDERRVE 1 321 .9 a 1 321 .7 22 –31 S3 ALHGQVYD ... 11 muecaloivmuiret ca bomo rh C snacifir t inedsullicaboihT e sA NR enorepahc/esaetorP DCP esaPTG nieto r PemeHneerG e sa lor dyH esaremosiedif...

Ngày tải lên: 08/03/2014, 08:20

11 517 0
Báo cáo khoa học: Puroindoline-a and a1-purothionin form ion channels in giant liposomes but exert different toxic actions on murine cells pptx

Báo cáo khoa học: Puroindoline-a and a1-purothionin form ion channels in giant liposomes but exert different toxic actions on murine cells pptx

... potential calculated for Ca 2+ was )17.3 mV and )26 .2 mV for 10 and 20 mm CaCl 2 , respectively. A Ca 2+ to Na + permeability ratio (P Ca ⁄ P Na ) of 5 was calculated from the changes in the measured ... Electrical signals after amplification were collected and digitized, at a sampling rate of 25 kHz, with the aid of a computer equipped with an analogue-to-digital...

Ngày tải lên: 07/03/2014, 12:20

13 436 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... prote- ases, blood coagulation factor XIIa and hepatocyte growth factor activator. Eur J Biochem 22 9, 25 7 26 1. 25 Miyazawa K, Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II transmembrane serine proteases...

Ngày tải lên: 15/02/2014, 01:20

13 641 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... view from bacterial genomics. Nat Prod Rep 24 , 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... Batagov A, Ward J, Baganz F & Krabben P (20 06) Identification of erythrobactin, a hydroxamate- type siderophore produced by Saccharopolyspora eryth-...

Ngày tải lên: 16/02/2014, 09:20

14 614 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... temperature. Assay procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sam...

Ngày tải lên: 18/02/2014, 14:20

9 457 0
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (20 03) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apoptosis ... predominantly expressed as two func- tionally active isoforms, caspase-8 ⁄ a and caspase-8 ⁄ b. J Biol Chem 27 2, 26 953 26 958. 25 Sohn D, Schulze-Osthoff K & Janicke RU (20 05) Cas...

Ngày tải lên: 19/02/2014, 06:20

11 679 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢ ,and PDE1(Lys 321 –Thr 620 ) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... African trypanosome Trypanosoma brucei is the protozoon that causes the fatal human sleeping sickness, as well as Nagana, a d...

Ngày tải lên: 19/02/2014, 12:20

11 566 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... Bio-Imaging analyzer BAS -25 00 using IMAGE GAUGE V3.3 software. Chromatin and protein DNA analysis Micrococcal nuclease (MNase) digestion and in situ cleavage by methidiumpropyl-EDTA–Fe(II) (MPE) was ... Biotechnology) and acetylated H3 (Upstate Bio- technology), and antibodies against specific modifications such as acetylated H3-K9 (Cell Signaling Technology) and H3-K14 (Abcam) an...

Ngày tải lên: 19/02/2014, 12:20

10 501 0
Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

... al., 20 03b; Lee and Seneff, 20 08; Nagata et al., 20 04; Nagata et al., 20 05; Nagata et al., 20 06; Tetreault et al., 20 10b). This is one of the most active research areas in natural language processing ... North American Chapter of the ACL, pages 154–1 62. Joel Tetreault, Elena Filatova, and Martin Chodorow. 20 1 0a. Rethinking grammatical error annotation and evaluation...

Ngày tải lên: 20/02/2014, 04:20

10 467 0
w