Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt

... expression of A- chain and structural studies Andre´L. C. Silva1, Leandro S. Goto1, Anemari R. Dinarte 2 , Daiane Hansen3, Renato A. Moreira4,Leila M. Beltramini1 and Ana P. U. Arau´jo11 ... silver-stained. An apparent molecular mass of  59 kDa forABCFig. 2. (A) A- chain expression analysis in SDS ⁄ PAGE, 15%. Lane 1, molecular mass marker; lanes 2 and 3, total proteins from E. coliAD 20 2–pGEX-rPAC ... cloning and structural studies A. L. C. Silva et al. 120 4 FEBS Journal 27 2 (20 05) 120 1– 121 0 ª 20 05 FEBSthe heterodimer is expected because the molecular mas-ses of rPAC and rPBC, are  29 .2 and 29 .8...

Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx

... 1944.1 a 1943.9 57– 72 D7 DDQVDAVTTLLNREYYN 24 02. 3 a 24 01.1 53– 72 D8 A GQVRMCEQN 22 89 .2 a 22 89.1 34– 52 B GQVRMCE 27 46.5 a 27 46.3 34–56S1 QNLE NS (5 02. 2) 45–48S2 VYTRDERRVE 1 321 .9 a 1 321 .7 22 –31S3 ALHGQVYD ... 11muecaloivmuiretcabomorhCsnacifirtinedsullicaboihTesANRenorepahc/esaetorPDCPesaPTGnietorPemeHneerGesalordyHesaremosiediflusid-loihTmulihpoelortepmuibolyhteMaeaporuesanomosortiN67EN57EN77EN87EN4-4-5632VC6632VC7632VC86 32 VC851114-4- 821 27 5119381dbT0481dbT1481dbT 24 81dbTacitamorasanomorolhceD754-4-1003oraD 20 03oraD3003oraD4003oraD31-8- 524 2AepM 624 2AepM 724 2AepM4-4-1192AepM4192AepM2192AepM553192AepM69 424 2AepMrotalugerlanoitpircsnarTFig. 5. Genetic organization of the GHP homologs from N. europeae, C. violaceum, T. denitriﬁcans, D. aromatica and ... of 11 kDa.Amino-acid sequence of GHP and molecularmassThe complete amino-acid sequence (Fig. 2) of GHPwas determined by a combination of automatedEdman degradation and tandem MS of peptides...

Báo cáo khoa học: Puroindoline-a and a1-purothionin form ion channels in giant liposomes but exert different toxic actions on murine cells pptx

... potential calculated for Ca 2+ was)17.3 mV and )26 .2 mV for 10 and 20 mm CaCl 2 ,respectively. A Ca 2+ to Na+permeability ratio(PCa⁄ PNa) of 5 was calculated from the changes in themeasured ... Electrical signals after ampliﬁcation werecollected and digitized, at a sampling rate of 25 kHz, withthe aid of a computer equipped with an analogue-to-digitalinterface board (DT 28 21; Data Translation, ... [ 32, 33].Patch-clamp data were analyzed off-line with TAC soft-ware (Bruxton Corporation, Seattle, WA, USA) and PulseFit (Heka Elektronic) software. All measurements weremade at  25 °C, and...

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... prote-ases, blood coagulation factor XIIa and hepatocytegrowth factor activator. Eur J Biochem 22 9, 25 7 26 1. 25 Miyazawa K, Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroduction Type II transmembrane serine proteases (TTSPs) arestructurally ... cycles), and 5¢-ATGGAGGCTGCTTGGGCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢for HAI-1 (26 cycles). The GAPDH-speciﬁc primer set,5¢-AGGTGAAGGTCGGAGTCAAC-3¢ and 5¢-TACTCCTTGGGAGGCCATGTG-3¢, was used...

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... view from bacterial genomics. Nat Prod Rep 24 , 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) For-oxymithine, a new inhibitor of angiotensin-convertingenzyme, ... Batagov A, Ward J, Baganz F & KrabbenP (20 06) Identiﬁcation of erythrobactin, a hydroxamate- type siderophore produced by Saccharopolyspora eryth-raea. Lett Appl Microbiol 42, 375–380. 20 ... the CAS assay-guided fraction-ation and enabled the scale-down of NRP discovery from a preparative to analytical scale. In addition, thisapproach can be utilized to substitute the detectionand...

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... antisense AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100 120 Counts ... temperature.Assay procedureThe assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads in the plate wells, and addition ... BioRad Protein Assay(BioRad, Espoo, Finland) with BSA (Sigma-Aldrich,St Louis, MO, USA) as the standard.Assay componentsStreptavidin-coated donor beads and protein A- coatedAlphaLISA acceptor...

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H,Hamasaki K et al. (20 03) Interferon -a sensitizes humanhepatoma cells to TRAIL-induced apoptosis ... predominantly expressed as two func-tionally active isoforms, caspase-8 ⁄ a and caspase-8 ⁄ b.J Biol Chem 27 2, 26 953 26 958. 25 Sohn D, Schulze-Osthoff K & Janicke RU (20 05) Cas-pase-8 can be activated ... interferon-alpha induced apoptosis inmalignant cells. Oncogene 21 , 125 1– 126 2.46 Saelens X, Kalai M & Vandenabeele P (20 01) Transla-tion inhibition in apoptosis – caspase-dependent PKRactivation and...

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢ ,and PDE1(Lys 321 –Thr 620 ) was ampliﬁed with primers 5¢-GGGAATTCCATATGAAGAATGATCAATCTGGCTGCGGCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢. ... African trypanosomeTrypanosoma brucei is the protozoon that causes the fatalhuman sleeping sickness, as well as Nagana, a devastatingdisease of domestic animals in large parts of sub-SaharanAfrica. ... truncated fragments of TbPDE1were also ampliﬁed using the same protocol and pET-PDE1as template. PDE1(Arg189–Thr 620 ) was ampliﬁed using theprimer pairs 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢...

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... Bio-Imaging analyzer BAS -25 00 usingIMAGE GAUGEV3.3 software.Chromatin and protein DNA analysisMicrococcal nuclease (MNase) digestion and in situ cleavageby methidiumpropyl-EDTA–Fe(II) (MPE) was ... Biotechnology) and acetylated H3 (Upstate Bio-technology), and antibodies against speciﬁc modiﬁcationssuch as acetylated H3-K9 (Cell Signaling Technology) and H3-K14 (Abcam) and anti-H3 C-terminal (Abcam). ... simultaneous addition of TA and TSA resulted in a digestion pattern indistin-guishable from that observed after treatment with TA aloneFig. 2. TSA treatment causes acetylation of bulk histones and acetyla-tion...

Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

... al., 20 03b; Lee and Seneff, 20 08; Nagata et al., 20 04;Nagata et al., 20 05; Nagata et al., 20 06; Tetreault etal., 20 10b). This is one of the most active researchareas in natural language processing ... NorthAmerican Chapter of the ACL, pages 154–1 62. Joel Tetreault, Elena Filatova, and Martin Chodorow. 20 1 0a. Rethinking grammatical error annotation and evaluation with the Amazon Mechanical Turk. ... Educational Applications, pages 28 –36.Alla Rozovskaya and Dan Roth. 20 10b. Trainingparadigms for correcting errors in grammar and us-age. In Proc. of 20 10 Annual Conference of the NorthAmerican...

Xem thêm