Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... using primers (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAA AATGGAGC AGAAA CTCATCTCTGAAGAGGATCTG -3¢) and (5¢- GCATGC CTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3¢), and checked for the presence and ... (5¢-AGCTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAATTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCAGAAACTCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3¢); for Golf(5¢-GGTACCGCTGCAATGGGGTGTTTGGGCAAC-3¢) ... was performed on DNAse-treated RNA extracts. Primers used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AGCTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAATTTTGCTGCC-3¢);...

Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of ﬂavonol synthase from Citrus unshiu pptx

... majus, Bromhaedia ﬁnlaysonia, Arabidopsis thaliana, Persea americana,Ipomea purpurea, Ipomea nil and Medicago sativa), three anthocyanidin synthases (Zea mays, Anthirrhinum majus and Oryza sativa), ... severalplant species (Petunia hybrida, Arabidopsis thaliana,Solanum tuberosum, Eustoma grandiﬂorum, Malus domestica and Matthiola incana), but functionality was only veriﬁed in case of Petunia and ... origin, catalyze reactions of medicinal and industrial relevance, and their spatial organization and mode of action are under investigation. The reactions arediverse, such as the desaturation of...

Báo cáo khoa học: Functional expression of the quinoline 2-oxidoreductase genes (qorMSL) in Pseudomonas putida KT2440 pUF1 and in P. putida 86-1 Dqor pUF1 and analysis of the Qor proteins doc

... putida host strains results in the forma-tion of catalytically competent enzyme.Materials and methodsPlasmids, bacterial strains and growth conditionsPlasmids and bacterial strains used in ... 1H-2-oxoquinoline(2-hydroxyquinoline) from quinoline [1,2]. Besides quino-line, some quinoline derivatives and the benzodiazinesquinazoline and quinoxaline are accepted as substrates [1,3].Like other enzymes catalysing ... spectroscopic, and – if possible – struc-tural characterization. A prerequisite for such a mutagenicapproach is the availability of a suitable system for themanipulation and the regulated, functional expression...

Báo cáo khoa học: Functional expression of Pseudomonas aeruginosa GDP-4-keto6-deoxy-D-mannose reductase which synthesizes GDP-rhamnose docx

... oundation and a grant from the Helsinki UniversityCentral Hospital Fund . We thank Dr Jari Helin and Leena PenttilaÈ for the MALDI-TOF M S analysis. Sirkka-Liisa Kaur anen and T uulaKallioinen ... structure of thesynthesized GDP-rhamnose.EXPERIMENTAL PROCEDURESStrains and culture conditionsThe bacterial and yeast strains and plasmids used in thisstudy are listed in Table 1. P. aeruginosa and ... identity matrix, a gap weight of 8, and a gap lengthweight of 0.1. Amino-acid sequences were aligned with thesame programs using a Blosum32 protein w eight matrix, a gap weight of 12, and a gap length...

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): reactivity and structure of metal–thiolate clusters* doc

... domains (a b-domain for the N-terminal cluster and an a- domain for the C-terminal cluster). In the absence of metals, apo-thionein (apo-T) is predominantly unstruc-tured and only upon metal ... [3]Primary structure 70% sequence identity 68 amino acids 61 amino acids20 cysteines, same arrangements Acidic 6-amino-acid insert in theC-terminal domainAbsence of 6-amino-acid and ThrinsertThr ... C-terminal a- domain (amino acids 31-61)binds four divalent metal ions by 11 deprotonatedcysteines in an adamantane-like cluster [M(II)4-Cys11],including ﬁve bridging and six terminal cysteines....

Tài liệu Báo cáo khoa học: Structural insights into the substrate speciﬁcity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

... cysteine proteasesfrom a tropical plant, Ervatamia coronariaRaka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa BiswasCrystallography and Molecular Biology ... ervatamin -A The overall structure and fold of ervatamin -A is simi-lar to that of ervatamin-B, ervatamin-C [27,35] and other members of the papain family, and is made up of two domains, L and ... of a particular DNA codon for an amino acidat a particular position for this family of plant cysteine pro-teases. The primers used were 5¢-TTGCCTGAGCA TGTTGATTGGAGAGCGA AAG-3 ¢ (forward) and...

Tài liệu Báo cáo khoa học: Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4 pptx

... trans-acting factors and ribosomal proteins in the pre60S particles throughregulation of RNA-RNA, RNA–protein and protein–protein interactions [43]. In yeast S. cerevisiae, involve-ment of ATP-dependent ... such as mammalian and frog sys-tems, resulting in the identiﬁcation of more than 80 yeast ribosomal proteins and numerous trans-actingelements including small nucleolar RNAs (snoRNAs)as well as ... human Gua and FLAG-tagged human RPL4 deletion mutant shown in (D) were immunoprecipitated using anti-FLAG resin and blotted as indicated.H. Yang et al. Gua–RPL4 interaction in mammalian rRNA productionFEBS...

Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx

... spectro-metry.SDS/PAGE was carried out in separating gels containing15% acrylamide. The following proteins were used asstandards: phosphorylase B (97 kDa), bovine serum albu-min (67 kDa), ovalbumin (45 kDa), ... determination and to D. Cavazzini(University of Parma) for helpful discussion and CD technicalassistance.Table 1. Catalytic parameters of A. radioresistens S13 PHR, alone and in the presence of PHI, ... concentration of 0.6 lM. The data were ﬁttedto Michaelis–Menten curves. Squares and dotted line: data and ﬁttingwith PHI/PHO ratio of 0.5. Triangles and continuous line: data and ﬁtting with...

Báo cáo khoa học: Monomeric molten globule intermediate involved in the equilibrium unfolding of tetrameric duck d2-crystallin pdf

... refraction [1–3]. Thermodynamic stability for crystallins is essential in maintaining lens transparency[4]. Determining the mechanism of folding and assembly of these proteins is important for ... endogenousargininosuccinate lyase activity of d2-crystallin was moni-tored as a function of the appearance of fumarate at240 nm. Tryptophan ﬂuorescence was measured by theemission spectra at an ... disturbanceFig. 6. Diagram of the surface of duck d-crystallin (1AUWÆpdb). (A) Each subunit of the tetrameric d-crystallin shows a surface with several convex and concave areas as indicated by a ,...

Báo cáo khoa học: Enzymatic toxins from snake venom: structural characterization and mechanism of catalysis ppt

... Typical ADAMs are type-1integral membrane proteins and have an epidermal-growth-factor-like domain, a transmembrane domain and a cytoplasmic domain, in addition to the metallo-proteinase ⁄ disintegrin ... processing of P-IIIb SVMPs. Jararhagin-C, catro-collastain-C and leberagin-C, which are D ⁄ C-domain-containing fragments isolated from Bothrops jararaca,C. atrox and Macrovipera lebetina, respectively, ... at site II.ADAM10 and ADAM17 are atypical members of ADAMs as they lack calcium binding sites I and III and the EGF domain. (B) Ribbon struc-ture of adamalysin II (PDB ID 1IAG), a structural...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hương BT Tieng anh 6 UNIT 2 chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ