Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAA AATGGAGC AGAAA CTCATCTC TGAAGAGGATCTG -3¢) and (5¢- GCATGC CTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and ... (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCT...

Ngày tải lên: 07/03/2014, 16:20

... majus, Bromhaedia finlaysonia, Arabidopsis thaliana, Persea americana, Ipomea purpurea, Ipomea nil and Medicago sativa), three anthocyanidin synthases (Zea mays, Anthirrhinum majus and Oryza sativa), ... several plant species (Petunia hybrida, Arabidopsis thaliana, Solanum tuberosum, Eustoma grandiflorum, Malus domestica and Matthiola incana), but functionality was only verified in case...

Ngày tải lên: 21/02/2014, 03:20

... putida host strains results in the forma- tion of catalytically competent enzyme. Materials and methods Plasmids, bacterial strains and growth conditions Plasmids and bacterial strains used in ... 1H-2-oxoquinoline (2-hydroxyquinoline) from quinoline [1,2]. Besides quino- line, some quinoline derivatives and the benzodiazines quinazoline and quinoxaline are accepted as substra...

Ngày tải lên: 17/03/2014, 10:20

... oundation and a grant from the Helsinki University Central Hospital Fund . We thank Dr Jari Helin and Leena Penttila È for the MALDI-TOF M S analysis. Sirkka-Liisa Kaur anen and T uula Kallioinen ... structure of the synthesized GDP-rhamnose. EXPERIMENTAL PROCEDURES Strains and culture conditions The bacterial and yeast strains and plasmids used in this study are listed...

Ngày tải lên: 17/03/2014, 11:20

... domains (a b-domain for the N-terminal cluster and an a- domain for the C-terminal cluster). In the absence of metals, apo-thionein (apo-T) is predominantly unstruc- tured and only upon metal ... [3] Primary structure 70% sequence identity 68 amino acids 61 amino acids 20 cysteines, same arrangements Acidic 6-amino-acid insert in the C-terminal domain Absence of 6-amino-aci...

Ngày tải lên: 16/02/2014, 15:20

... cysteine proteases from a tropical plant, Ervatamia coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa Biswas Crystallography and Molecular Biology ... ervatamin -A The overall structure and fold of ervatamin -A is simi- lar to that of ervatamin-B, ervatamin-C [27,35] and other members of the papain family, and is made up of...

Ngày tải lên: 18/02/2014, 16:20

... trans-acting factors and ribosomal proteins in the pre60S particles through regulation of RNA-RNA, RNA–protein and protein– protein interactions [43]. In yeast S. cerevisiae, involve- ment of ATP-dependent ... such as mammalian and frog sys- tems, resulting in the identification of more than 80 yeast ribosomal proteins and numerous trans-acting elements including small...

Ngày tải lên: 20/02/2014, 01:20

... spectro- metry. SDS/PAGE was carried out in separating gels containing 15% acrylamide. The following proteins were used as standards: phosphorylase B (97 kDa), bovine serum albu- min (67 kDa), ovalbumin (45 kDa), ... determination and to D. Cavazzini (University of Parma) for helpful discussion and CD technical assistance. Table 1. Catalytic parameters of A. radioresistens S13 PH...

Ngày tải lên: 21/02/2014, 00:20

... refraction [1–3]. Thermodynamic stability for crystallins is essential in maintaining lens transparency [4]. Determining the mechanism of folding and assembly of these proteins is important for ... endogenous argininosuccinate lyase activity of d 2 -crystallin was moni- tored as a function of the appearance of fumarate at 240 nm. Tryptophan fluorescence was measured by the...

Ngày tải lên: 08/03/2014, 08:20

... Typical ADAMs are type-1 integral membrane proteins and have an epidermal- growth-factor-like domain, a transmembrane domain and a cytoplasmic domain, in addition to the metallo- proteinase ⁄ disintegrin ... processing of P-IIIb SVMPs. Jararhagin-C, catro- collastain-C and leberagin-C, which are D ⁄ C-domain- containing fragments isolated from Bothrops jararaca, C. atrox and M...

Ngày tải lên: 14/03/2014, 22:20