Báo cáo khoa học: D88A mutant of cytochrome P450nor provides kinetic evidence for direct complex formation with electron donor NADH ppt

... D88A mutant of cytochrome P450nor provides kinetic evidence for direct complex formation with electron donor NADH Mariko Umemura 1 , Fei Su 1 , Naoki Takaya 1 , Yoshitsugu Shiro 2 and Hirofumi ... properties, providing kinetic evidence for the direct complex formation of P450nor with NADH. Materials and methods Mutagenesis and expression pla...

Ngày tải lên: 07/03/2014, 15:20

... holo -formation is obvi- ous. This prompted us to re-examine the heterologous synthesis of cytochromes c¢ with or without co- expressed ccm genes from a plasmid. In addition, the effects of Dsb ... observed for the reduced form of PHCP, which is characteristic of a pentacoordinate heme with a His residue as an axial ligand [14]. Furthermore, a peak around 630 nm was observed f...

Ngày tải lên: 06/03/2014, 00:20

... x-1, x-2 and x-3 hydroxylation of myristic acid is believed to be required for the generation of pimelic acid equivalents for biotin biosynthesis. Pimelic acid is formed by P450-mediated in-chain ... microsomes. I. Evidence for its hemo- protein nature. J Biol Chem 239, 2370–2378. 2 Kahn RA & Durst F (2000) Function and evolution of plant cytochrome P450. In Evolution of...

Ngày tải lên: 22/03/2014, 16:21

... binding of dioxygen and the formation of the ferrous–dioxygen intermediate. The second electron addition, followed by protonation, forms the ferric hydroperoxy complex. The O–O bond is cleaved, with ... University of Oxford, Oxford, UK; 2 Institute of Technical Biochemistry, University of Stuttgart, Stuttgart, Germany Cytochrome P450 BM3 is a self-sufficient fatty acid mono-...

Ngày tải lên: 23/03/2014, 21:20

... that RGG3 of EWS binds mainly to the G-quadruplex. To test whether formation of the G-quadruplex is necessary for RGG3 binding, we assayed the binding of RGG3 with Htelo in the presence of K + or ... Htelo binding of RGG3. To gain further insight into the induction of G-quad- ruplex formations by RGG3 of EWS, we performed a CD spectroscopic analysis that was conducted wit...

Ngày tải lên: 15/02/2014, 01:20

... by three-fold extraction with 50% NaCl ⁄ chloroform (1 : 1 v ⁄ v). A new volume of chloroform was used for each of the three extractions. Finally, the organic phase was re-extracted with de-ionized water ... an D 540 nm of 0.4 for O35E (1.3 · 10 9 CFUÆmL )1 ), an D 540 nm of 0.43 for O35ElpxX (1.0 · 10 9 CFUÆmL )1 ), or an D 540 nm of 0.4 for O35ElpxL (1.8 · 10 9 CFUÆmL...

Ngày tải lên: 18/02/2014, 14:20

... dis- covery of the reversibility of IB formation [6], the gen- eral acceptance of IBs being formed by functional proteins [7] and the recognition of the amyloid-like architecture of IB proteins ... process drives the formation of IBs in bacteria. (A) In vivo formation of IBs in recombinant bacteria. Aggregation-prone versions of the recombinant protein (green) slowly for...

Ngày tải lên: 06/03/2014, 00:20

... was used. For the D370M mutant, primer RDmutM1 (5¢-CCGGTGCC AGTGCTCGGT CATGGGATCGGGCCACGACGACA GC-3¢) was used. For isolation of S112A mutants, site- directed mutagenesis was performed with the ... the side chain of Tyr170 is rotated. Through the combined effect, Tyr170-O g moves a total of approximately 11 A ˚ , resulting in the formation of hydrogen bonds with the nitroge...

Ngày tải lên: 07/03/2014, 00:20

... pressure–temperature plane of measurements for the inactivation studies when start- ing with a buffer of pH 6.0 at ambient conditions (for a graph of the pH of Mes buffer plotted as a function of pressure and ... first part of this inactivation took place at pressures below 300 MPa and was not visible as a conformational transition. The second transition in activity was concom...

Ngày tải lên: 07/03/2014, 03:20

... could form an insoluble complex, resulting in their continuous removal from the reaction by precipitation and a shift of the equilibrium in favor of CD formation [18]. The reuse stability of the ... occurred after 6 h of reaction with the CLIP CGTase from A11. The differ- ences in the time course of CD 8 formation detected depended on the type of CGTase used, and are in acc...

Ngày tải lên: 07/03/2014, 10:20