0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt

Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt

Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt

... screen; glycerol; osmoregulation. The discovery of the aquaporins marked a breakthroughin our understanding of water and solute transmembrane transport [1]. Aquaporins and aquaglyceroporins [the majorintrinsic ... family] have been found in archea,eubacteria, fungi, plants, animals and human [2,3]. Aqua-porins facilitate the diffusion of water across biologicalmembranes while the closely related aquaglyceroporinsmediate ... Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen Sara Karlgren1, Caroline Filipsson2, Jonathan G. L. Mullins3,...
  • 9
  • 383
  • 0
Báo cáo khoa học: Identification of tyrosine-phosphorylation sites in the nuclear membrane protein emerin pot

Báo cáo khoa học: Identification of tyrosine-phosphorylation sites in the nuclear membrane protein emerin pot

... Ogawa M, Kurano Y, Kawada J,Okada R, Hayashi YK, Tsukahara T & Arahata K(1996) Emerin deficiency at the nuclear membrane inpatients with Emery–Dreifuss muscular dystrophy. NatGenet 12, 254–259.34 ... and some applica-tions. Proc Natl Acad Sci USA 76, 4350–4354.44 Laemmli UK (1970) Cleavage of structural proteinsduring the assembly of the head of bacteriophage T4.Nature 227, 680–685. A. ... encloses the genetic material of a eukaryotic cell and takes part in its structural andfunctional organization. It consists of interconnectedmembranes, an outer nuclear membrane (ONM) andan inner...
  • 12
  • 429
  • 0
Báo cáo khoa học: Identification of versican as an isolectin B4-binding glycoprotein from mammalian spinal cord tissue pptx

Báo cáo khoa học: Identification of versican as an isolectin B4-binding glycoprotein from mammalian spinal cord tissue pptx

... glycoconjugate and the versican variant can be co-releasedfrom spinal cord membranes by hyaluronidase, and that the IB4-reactiveglycoconjugate and the versican variant can be co-precipitated by an anti-versican ... perfectly matchedwith sequences of the pig versican according to data-base entry AAF19155.1 (Fig. 6). The data bank search indicated versican as the onlysignificant match. Laminin and the light- and ... for the plant isolectin B4(IB4) from Griffonia simplicifolia. The molecular nature of the IB4-reactiveglycoconjugate, although used as a neuroanatomical marker for more than a decade, has remained...
  • 13
  • 447
  • 0
Báo cáo khoa học: Identification of RNase HII from psychrotrophic bacterium, Shewanella sp. SIB1 as a high-activity type RNase H pot

Báo cáo khoa học: Identification of RNase HII from psychrotrophic bacterium, Shewanella sp. SIB1 as a high-activity type RNase H pot

... S, Oda Y, Nakai T, Katayanagi K, Kitakuni E,Katsuda-Nakai C, Nakamura H, Ikehara M & KanayaS (1992) Effect of the cavity-modulating mutations on the stability of E. coli ribonuclease HI. ... Kanaya S, Katsuda C, Kimura S, Nakai T, Kitakuni E,Nakamura H, Katayanagi K, Morikawa K & IkeharaM (1991) Stabilization of Escherichia coli ribonucleaseH by introduction of an artificial ... archaeal RNase HII: a homologue of human major RNase H. Structure 8, 897–904.16 Muroya A, Tsuchiya D, Ishikawa M, Haruki M, Mori-kawa M, Kanaya S & Morikawa K (2001) Catalyticcenter of an archaeal...
  • 12
  • 371
  • 0
Báo cáo khoa học: Identification of alternative promoter usage for the matrix Gla protein gene Evidence for differential expression during early development in Xenopus laevis doc

Báo cáo khoa học: Identification of alternative promoter usage for the matrix Gla protein gene Evidence for differential expression during early development in Xenopus laevis doc

... +2852XlMGPF7 CCGGAGCTCACTACCAAATAGAGCCTCC +1278XlMGPF8 ATCTCAAAGTTCCTTCATAGAG +1XlMGPF9 ATGAAGACTCTTCCAGTTATTC +3032XlMGPF10 CCGGAGCTCGAGCCACCAAAATAACTTCTAGATCGTAAAAATTTGCC +2818ODC-specific ... primersXlMGPR1 CACGCAAGCTTGACTTCTTGCTGTTAGAGG +3013XlMGPR2 GGGAAGTGACTGCAACATAGAGAC +7964Sense XlMGP-specific primersXlMGPF1 CCGGAGCTCATCAGACTGATAATCTGTG +2123XlMGPF2 CCGGAGCTCAGCATCACTTATCAGATGC ... Relative Luciferase Units (fireflyluciferase activity ⁄ Renilla luciferase activity). Each assaywas performed in triplicate and repeated at least twice.RNA preparationTotal RNA was prepared using...
  • 10
  • 457
  • 0
Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

... data were captured using a FujiLAS-1000 Imaging System CCD camera (aida 2.11 soft-ware for analysis).ACE2 ⁄ ACE activity assaysFluorogenic assays using the synthetic ACE2 substrate,Mca-APK(Dnp) ... course. The reaction product was quantified by using standard solutions of Mca.AcknowledgementsWe thank the Medical Research Council of Great Brit-ain (MRC) and the National Heart Research Fund(NHRF) ... site.In fact, the distance of this positive charge from the surface of the binding pocket is also crucial.Role of His505 and His345 in catalysisSequence alignment of ACE2 with ACE revealed thatthe...
  • 9
  • 789
  • 2
Báo cáo khoa học: Identification of crucial residues for the antibacterial activity of the proline-rich peptide, pyrrhocoricin pot

Báo cáo khoa học: Identification of crucial residues for the antibacterial activity of the proline-rich peptide, pyrrhocoricin pot

... IEAKIEAVIKASEPLMQAVQAKAQQAGGEQPQQHaemophilus ducreyi 583-615 IEAKIEAVIKASEPLMQAAQAKAQTNQAGEQQSHelicobacter pylori 578-607 AELEDKTKLLAQAAQKLGEAMANKNNAEQPPseudomonas aeruginosa 584-615 IEAKMNALSQASTPLAQKMYAEQAQQGEDAPQStaphylococcus ... C-terminus.For the Ala-scan of the DnaK D-E helix region, all native residues were replaced with alanine. The three nativealanines, Ala591, Ala601 and Ala606 were replaced withphenylalanine. The sequence ... IEAKMNALSQASTPLAQKMYAEQAQQGEDAPQStaphylococcus aureus 554-585 IKSKKEELEKVIQELSAKVYEQAAQQQQQAQGStreptococcus pyogenes 554-588 MKAKLEALNEKAQALAVKMYEQAAAAQQAAQGAEGStreptococcus pneumoniae 554-588 MKAKLEALNEKAQQLAVKLYEQAAAAQQAQEGAEGCandida...
  • 12
  • 442
  • 0
Báo cáo khoa học: Identification of two cysteine residues involved in the binding of UDP-GalNAc to UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) ppt

Báo cáo khoa học: Identification of two cysteine residues involved in the binding of UDP-GalNAc to UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) ppt

... cysteine residues into eitheralanine or serine residues. C10 6a, 5¢-TAGAGGGGGCTAAAACAAAA-3¢; c21 2a, 5¢-ACTGTGCACTCGGCGTGAGC-3¢; c21 4a, 5¢-ACTGTGGCCTCGCAGTGAGC-3¢;c23 5a, 5¢-TAGGAGCCACCACTGTCCTC-3¢; ... otherGalNAc-transferases contain different amino acids at thesepositions, such as DSHVEC (GalNAc-T5), DAHCEV(GalNAc-T7), DAHIEV (GalNAc-T8), DAHVEF(GalNAc-T9), and DSHCE A (ppGaNTase-T9). Of theseisozymes ... Kyoto, Japan;3Pharmacia Corporation, Kalamazoo, Michigan, USABiosynthesis of mucin-type O-glycans is initiated by a family of UDP-GalNAc:polypeptide N-acetylgalactosaminyl-transferases, which...
  • 9
  • 435
  • 0
Báo cáo khoa học: Identification of critical residues of subunit H in its interaction with subunit E of the A-ATP synthase from Methanocaldococcus jannaschii potx

Báo cáo khoa học: Identification of critical residues of subunit H in its interaction with subunit E of the A-ATP synthase from Methanocaldococcus jannaschii potx

... Backbone1H,13C, and15N resonanceassignments of subunit F of the A 1 A 0ATP synthasefrom Methanosarcina mazei Go¨1. Biomol NMR Assign1, 23–25.17 Maegawa Y, Morita H, Iyaguchi D, Yao M,Watanabe N & ... integral membrane A 0domain,involved in ion translocation [2–4]. The primary struc-ture of the archaeal ATP synthase is similar to that of the eukaryotic V-ATPase, but its function as an ATPsynthase ... synthase forms one of the peripheral stalks connecting the A 1and A 0sections. Structural analyses of the N-terminal part (H1–47) of subunit H of the A 1 A 0ATP synthase fromMethanocaldococcus...
  • 10
  • 351
  • 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... to 95 °C on a thermal heating block and cooling to 4 °C at a rate of 2 °CÆmin–1.Name SequencessDNAS d(CATTCCCACCGGGACCACCAC)ssDNA L d(CATTCCCACCGGGACCACCACCATTCCCACCGGGACCACCAC)ETS-1 d(TCTCTCGGTGGCCGGGGCTCGTCGGGGTTTTGGGTCCGTCC)Htelo ... ACA G)and EWS reverse d(CGC TCG AGT CAC TAG TAG GGCCGA TCT CTG C), for pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA GAC ... compilation ª 2011 FEBS Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding proteinKentaro Takahama1,*, Katsuhito Kino2,*, Shigeki Arai3, Riki Kurokawa3and Takanori...
  • 11
  • 786
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ