Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx
... that product abundance was evaluated in the exponential phase of the reaction (half of the maximum product). To further validate the assays, the optimized cycle number (23 and 28 for gpd and lac1, ... standard assay mixtures, the velocity of ABTS oxidation was maximal at 45 °C. The dependence of the rate of ABTS oxidation by lac1 on substrate concentration at pH...
Ngày tải lên: 07/03/2014, 15:20
... 5¢-AAGATGAAACGTG AGACGG-3¢ (CA1); 5¢-GATGACATCTCCATGGAA TAC-3¢ (CA2). The 3¢ region of the hazelnut LOX cDNA was amplified using the following primers: 5¢-GTTT GGAAGAGAGATGCTGG-3¢ (CA3); 5¢-AAAGTTTTT AGATTGAGACACTATTGGGAATT-3¢ ... Hazelnut seeds contain reasonable levels of linoleic and linolenic acid (about 10 and 0.2%, respectively, of the total fatty acids) and hexanal...
Ngày tải lên: 21/02/2014, 00:20
... (A ˚ .mol) was reached. The rmsd between the initial and the optimized model was 1.4 A ˚ (calculated on 124 a- carbons). The Ramachandran plot statistics of ChPLA 2 and the complex ChPLA 2 –substrate analog model ... PPLA 2 , taken as a model of mammal PLA 2 , can tolerate incubation at high temperature (Fig. 3B). Effect of pH on ChPLA 2 activity and stability...
Ngày tải lên: 30/03/2014, 01:20
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... Æmin )1 . The subunit molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activity of HYD Js with d-p- HPH as substrate ... homotetramers [4]. Gel filtration analysis of native HYD Js indicated a molecular mass of about 253 kDa, and, as the subunit molecular mass of the His-ta...
Ngày tải lên: 18/02/2014, 08:20
Báo cáo khoa học: Biochemical and spectroscopic characterization of the bacterial phytochrome of Pseudomonas aeruginosa pdf
... recognized as a PAS domain in the Pfam database (protein families data- base; http://www.sanger.ac.uk/Software/Pfam/) [12]. PAS domains are tandem repeats first described in the transcriptional regulatory ... sites: bphPXbaRBSfwd: 5¢-CG TCTAGATAACGAGGGCAAAAAATGACGAG CATCACCCGGTTACC-3¢; bphPXhonoSTOPrev: 5¢-CC CTCGAGGGACGAGGAGCCGGTCTCCG-3¢. The PCR product was digested with the indica...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Biochemical and structural characterization of mammalian-like purine nucleoside phosphorylase from the Archaeon Pyrococcus furiosus pptx
... bridges that play a role in the stability of the enzyme against thermal inactivation. The characterization of the thermal properties of the C254S ⁄ C256S mutant suggests that the CXC motif in the C-terminal region ... on the molecular and structural characterization of PNPs from hyperthermophilic Archaea could be useful to improve the tumor-directed gene...
Ngày tải lên: 23/03/2014, 09:21
Báo cáo khoa học: Synthesis and structural characterization of a mimetic membrane-anchored prion protein doc
... bandwidth was 2 nm and the scanning speed was 200 nmÆmin )1 with a response time of 1 s and a data pitch of 0.5 nm. Typically, 16 spectra were averaged and buffer baselines were subtrac- ted from the data. Lipid-anchored ... average of 1024 spectra collected at room temperature (21 °C). The water vapour signal was removed from the spectra and peak fitting was perf...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: Biochemical and structural analyses of a higher plant photosystem II supercomplex of a photosystem I-less mutant of barley pot
... SDS ⁄ PAGE analysis (Fig. 4A) . The absence of the ATPase complex indicates that the treatment produced grana membranes free from stroma lamellae. Among a range of detergent concen- trations used, ... appearance of negatively stained dimeric PSII core arrays [14,37,39–41]. The arrangement of the particles within the array is such that they are substan- tially separated...
Ngày tải lên: 30/03/2014, 10:20
Báo cáo khoa học: Isolation and identification of antimicrobial components from the epidermal mucus of Atlantic cod (Gadus morhua) docx
... antimicrobial activity against Bacillus mega- terium, Escherichia coli and Candida albicans. This activity varied signifi- cantly when salt was added to the antimicrobial assay, and was eliminated by ... as well as against the yeast C. albicans. As seen in Fig. 1 and Table 1, the anti- Candida activity was fully inhibited when the salt concentration was increased in the assay b...
Ngày tải lên: 23/03/2014, 15:21
Tài liệu Báo cáo khoa học: Bioinformatic and enzymatic characterization of the MAPEG superfamily doc
... primer, 5¢-GAGA GAGGATCCATATGACAAAAACCGAGTTAC-3¢, NdeI site; antisense primer, 5¢-GAGAGAAAGCTTCAAAACT GGGACAGTTG-3¢, HindIII site. The same method was used to amplify the coding sequence for the E.coliMGST, ... to the nucleo- tide sequence 10 655–11 080 in the E. coli genome with a GTG start. Sense primer, 5¢-GAGAGACATATGCCA TCGGCCATTTTAAAG-3¢; antisense primer, 5¢ -GAGA GAAAGCTTC...
Ngày tải lên: 19/02/2014, 17:20