... derivative of this function. The flux rate of CO 2 into sucrose synthesis (r CO 2 !Suc ) was caclulated as the difference between the rate of net photosynthesis and that of net starch synthesis (unit: C 6 h )1 Æg )1 FW): r CO 2 !Suc ¼ ... trajec- tory of interconversion rates as a function of time of cold exposure, (b) comparison of the magnitudes of the various i...
Ngày tải lên: 14/02/2014, 22:20
... NY. 32 Nijhout HF, Smith WA, Schachar I, Subramanian S, Tobler A & Grunert LW (2007) The control of growth and differentiation of the wing imaginal disks of Mand- uca sexta. Dev Biol 30 2, ... to affinity chromatogra- phy. Aliquots of the input and the eluate of the chromatography were resolved by Tricine ⁄ SDS ⁄ PAGE and then analyzed by Coo- massie Brill...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural specificity variants doc
... an opportunity to gain insight into the mechanism of amino acid recognition in the arginine system. Results On the basis of the annotated Arabidopsis genome, we established the cDNA sequence of the argS ... leaving one to speculate on the source of the interaction with the sugar–phosphate backbone. Correct positioning of the essential Ade76 of the tRNA ha...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx
... regulation of HOXC 13. E2-induced recruitment of ERs and MLLs in the HOXC 13 promoter As the HOXC 13 promoter contains several ERE1 ⁄ 2 regions within the first 30 00 nucleotides upstream of the transcription ... in any of the EREs, irrespective of the absence and presence of E2. Binding of ERa and ERb was increased in both ERE1 and ERE2 of the HOX...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Tryptophan tryptophylquinone cofactor biogenesis in the aromatic amine dehydrogenase of Alcaligenes faecalis Cofactor assembly and catalytic properties of recombinant enzyme expressed in Paracoccus denitrificans pptx
... alog (pH ) pK a2 ), Lim1 is the lower limit of the curve, Lim 2 is the middle limit of the curve and Lim 3 is the upper limit of the curve. Stopped-flow kinetic studies of the oxidative half-reaction ... (5¢-GGAGGGATCCCATATG AAGTCTAAATTTAAATTAACG -3 ) and reverse (5¢-GC GTG CTCGAGCGATCCATGGAGCCGTA -3 ) primers that incorporated BamHI and NdeI restriction sites in...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio Role of the seventh histidine and accessibility to the active site docx
... and 0.05% SDS, and DO activity at pH 7 and 0.02% SDS. Fig. 3. Dependence of the TH activity of extracts of R3 and the two mutant strains on the presence of cofactor, L-dopa. (n) R3; (d) R3- 033 7 – which ... found in the extracts of R3-1501 – , and the opposite was observed in extracts of R3- 033 7 – mutant. This behavior clearly suggests that these peaks are...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
... a3b4* PIA RDPCCSNPVCTVHNPQIC a6/a3b2 0.69 [39 ] a6/a3b2b3 0.95 [39 ] ha6/a3b2b3 1.72 [39 ] a3b2 74.2 [39 ] a6/a3b4 30 .5 [39 ] ha6/a3b4 12.6 [39 ] a6b4 33 .5 [39 ] a3b4 518 [39 ] AnIB GGCCSHPACAANNQDYC a7 76 [ 83] a3b2 0 .3 [ 83] a Sequence ... ha3b2 1.1 [38 ] ha3b4 755 [38 ] ha4b2 30 9 [38 ] GID IRDcCCSNPACRVNNOHVC a7 4.5 [80] a3b2 3. 1 [80] a4b2 152 [80] Vc1.1 GCCSDPRCNYDHPEIC bCCc 1...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt
... pyruvate, and meth- ylamine are bound to the enzyme in this order, and N-methyl-l-alanine and then NADP + are released from the enzyme. Therefore, the kinetic mechanism of the enzyme is the same ... dehydrogenase [33 ], ureidoglycolate dehydrogenase [34 ], and 2 ,3- diketo-l-gulonate reductase [35 ]. The action on a-oxo acids as substrate is common to all these enz...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf
... cross-validation into training and test subsets with the ratio of 9:1 we randomly split the data into training, validation and test sets with the ratio of 8:1:1. We then run our experiments and measured ... 0 .35 00±0.0272 0.4687±0.0284 1000 0.7 435 ±0.0556 0 .33 50±0.0197 0.4614±0.0250 1500 0.7460±0.0529 0 .31 60±0.0150 0.4 435 ±0.0206 2000 0.7504±0.0 235 0 .30 68±0.0141 0. 4...
Ngày tải lên: 20/02/2014, 04:20
Tài liệu Báo cáo khoa học: A peptide containing a novel FPGN CD40-binding sequence enhances adenoviral infection of murine and human dendritic cells doc
... migration to lymph nodes and secretion of interleukin-12 and other pro-inflammatory cytokines [2–4]. On B cells, CD40 engagement prolongs survival and promotes their differentiation into memory cells ... binds to murine CD40, and promotes the uptake of adenoviruses into CD40-expressing cells of both murine and human origin, suggesting that it may have potential...
Ngày tải lên: 20/02/2014, 11:20