Báo cáo khoa học: Puriﬁcation and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot

... Hordeum A. A.N N-QRIN LQ GG IFW AGAD ASDA.NS.VS D. D 113 Triticum G .A. S N-QRIN LQ GG IFW AGAD AADA.NA.VG D. D 113 Zea AYA.S A- QRQG LI GG FW AGAD.SASDA.GS.VS QY.DHDT.S. 112 Nicotiana AYA.N S-Q.AA ... GAG TCA GCC TCC CTC ACA ACA CCA 21673TTREEQPAAEAAASTAGGSQACC ACC AGG GAA GAA CAA CCG GCG GCA GAG GCC GCG GCG TCC ACC GCT GGC GGT AGC CAA 27693QEGYGSTQLPSDEPLNGLNDCAA GAA GGA TAT GGC AGC ACC ... cloned and characterized Cyn d 24 as a novel pathogenesis-related protein from BGP. Additionally, the identiﬁcation of Cyn d 24 hasidentiﬁed the involvement of a novel class of PR pro-teins in pollen...

Báo cáo khoa học: Puriﬁcation and structural study of the b form of human cAMP-dependent protein kinase inhibitor pdf

... witholigonucleotides 5¢-CCCCATATGATGAGGACAGATTCATCAAAAATG-3¢ and 5¢-CATGGATCCTCATTTTTCTTCATTTTGAGGC-3¢. The ampliﬁed PCR fragmentwas inserted into plasmid vector pET between the endo-nuclease sites NdeIandHindIII. ... signal ATTAAA (1018–1023) and poly (A) tail (Fig. 1). The human PKIb protein predicted by the open reading frame is 78 amino acids inlength with a calculated molecular mass of 8468.2 Da and PI of ... bands, determined by band ﬁtting of the absorbance spectrum of Fig. 4A, are shown in Fig. 6 and Table 2. From Table 2, the sum of individual amide I¢intensity and the intensity percent of each...

Báo cáo khoa học: Puriﬁcation and kinetic analysis of the two recombinant arogenate dehydrogenase isoforms of Arabidopsis thaliana pptx

... of the two A. thaliana arogenate dehydrogenases TyrAAT1 and TyrAAT2 deduced from their respective coding sequences (A) and alignment of amino acidsequence of the two protein domains of TyrAAT1 ... synthase and shiki-mate kinase, and not less than six for arogenatedehydratase. Analysis of the patterns of expression of the two A. thaliana arogenate dehydrogenases in differentorgans and in ... report the puriﬁcation and detailed kinetic characterization of A. thaliana arogenatedehydrogenase. Both isoforms exhibit initial velocitypatterns in the absence and presence of products and dead...

Tài liệu Báo cáo khoa học: Puriﬁcation and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... two additional residues, Leu and Val, at the C-terminus, which are cleaved duringmaturation.Fig. 2. cDNA and the deduced precursorsequence of conomarphin. The signal pep-tide is shadowed and ... shadowed and the mature peptide isunderlined. The polyA signal AATAAA in the 3¢-UTR is also underlined. The cDNA of con-omarphin has been deposited in the Gen-bank database with the accession ... chymotrypsin was used to digest natu-ral conomarphin and the synthetic peptide DWEY-HAHPKONSFWT. The cleaved fragments wereanalyzed on a C-18 HPLC column and were assignedon the basis of their relative...

Tài liệu Báo cáo khoa học: Puriﬁcation and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... nucleotide and amino acid are indicated in the right of each row. The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A putative signal ... Relative positions of Hd1-DNA, Hd2-DNA, Hd5RACE-DNA, Hd3RACE-DNA, and HdFull-DNA are indicated as solid lines. Bold lines in both sides of the cDNAsindicateprimersusedforthePCR.LengthsofthecDNAsareshown ... protocol. Double-stranded cDNA was syn-thesized from the mRNA with a cDNA synthesis kit(TaKaRa, Tokyo, Japan) and used as an abalone cDNAlibrary. cDNAs encoding abalone cellulase were ampliﬁedby...

Báo cáo khoa học: Identiﬁcation and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus inﬂuenzae pptx

... residue are indicated. (B) The assignments of the 1H-resonances of the GlcNAc and Gal II residues are indicated. The spectrum was recorded in D 2O at pH 7.0 and 295 K.4016 A. D. Cox et al. ... acceptor the sialylated tetrasaccharide unit cannot be attached. In strainRM118, and the RM118 lgtC mutant strain, we have nowidentiﬁed two different sialylated species, namely Sial-Lac and ... 4019Identiﬁcation and structural characterization of a sialylatedlacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus inﬂuenzaeAndrew D. Cox1, Derek W. Hood2, Adele Martin1,...

Báo cáo khoa học: Puriﬁcation and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc

... PCRusing the 5¢-primer (CGCCATATGGCTACTAAAGCTGCTCGTGTTCCACGTACAGTGCTGCCA) and 3¢-primer(GCGAAGCTTAATGATGATGATGATGATGGTTGATGGCTCTGAAGGTGAGGAG) and inserted into the NdeI ⁄ HindIII-digested pET17b ... expression of AdR and Adx. The plasmid containing the coding sequence for AdRwas kindly provided by Y. Sagara [32]. Recombinant Adx and AdR were puriﬁed as described previously [33,34].Functional characterization ... absorption band [22]. Upon addition of substrate, the signal of the positive CD bandat 290 nm and the negative band at 386 nm decreased(Fig. 4B). A similar observation was described for sub-strate...

Báo cáo khóa học: Puriﬁcation and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt

... addition, the N-terminal and internal amino-acid sequences deduced from the cloned gene were the same as those determinedby Edman degradation. The recombinant protein expressed by E. coli waspuriﬁed ... degra-dation (data not shown). Another insecticidal protein wasalso puriﬁed from fraction ii. This protein migrated as a single band at a molecular mass of 34 kDa on electrophor-esis on SDS/10% ... toxin producedbyB. cereus The N-terminal and internal amino-acid sequences of the puriﬁed toxic protein were analyzed by Edman degrada-tion. The N-terminal amino-acid sequence was determined602...

Báo cáo khoa học: Puriﬁcation and partial characterization of seven glutathione S -transferase isoforms from the clam Ruditapes decussatus pptx

... collected from the lagoon of Thau (N.W.Mediterranean sea) and placed on ice for transport to the laboratory. They were then transferred to a 200-L aquariumﬁlled with natural aerated sea water, in a ... cross-reacted with antiserato pi and alpha classes and the isoform 5-5 cross-reacted with the antisera to mu and pi classes. Subunit 4 was recognizedby the three antisera used, and its N-terminal amino ... diluted 1 : 500 and a rabbit anti-(alpha class GST) (polyclonal antibody; Inter-chim) diluted 1 : 2000.RP-HPLCHPLC analysis of each of the four afﬁnity fractions and of all the anion exchange...

Báo cáo khoa học: Identiﬁcation and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) doc

... partial deletion of exon 2. However, this deletion did not disrupt protein translation and thus the alternative spliced mRNAremained in-frame and potentially translated into a 182amino acid ... cytokine.Materials and methodsCloning and sequencing of genomic DNA and cDNAAll products ampliﬁed by PCR were ligated into the pGEM-Teasy vector (Promega) and transformed intoTAM competent cells (ActiveMotif, ... sequences. (B) The two transcripts, IL-1 8A and IL-18B, resulting from the normal and the alternative splicing, and the deduced amino acid sequences.Table 2. Protein similarity and features of trout...

Xem thêm