Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx

Tài liệu Báo cáo khoa học: Regulation of dCTP deaminase from Escherichia coli by nonallosteric dTTP binding to an inactive form of the enzyme ppt

Tài liệu Báo cáo khoa học: Regulation of dCTP deaminase from Escherichia coli by nonallosteric dTTP binding to an inactive form of the enzyme ppt

... of the active site and rearrangement of the main chain and side chains in the active site appear as key players in a slow transformation from an inactive to an active enzyme. dTTP inhibition may then ... to that observed for dUTPase. For both the mono- and bifunctional dCTP deaminases, as we show here, and the dUTPase [24], the C-terminal fold is important for the...

Ngày tải lên: 18/02/2014, 16:20

11 577 0
Báo cáo khoa học: The transcription factor ZBP-89 suppresses p16 expression through a histone modification mechanism to affect cell senescence doc

Báo cáo khoa học: The transcription factor ZBP-89 suppresses p16 expression through a histone modification mechanism to affect cell senescence doc

... 5¢-AGACAGCCGTTTTACACGCAG-3¢; P2 antisense, 5¢-CACCGAGAAATCGAAATCACC-3¢;P3 sense, 5 ¢-TAGGAAGGTTGTATCGCGGAGG-3¢; and P3 antisense, 5¢-CAAGGAAGGAGGACTGGGCTC-3¢ [28]. The locations of P1, P2 and ... primer pairs for p16 were as follows: sense, 5¢-TTCCTGGACACGCTGGT-3¢; and antisense, 5¢-CAATCGGGGATGTCTGAG-3¢. The b-actin primer pairs were as follows: sense, 5¢-TCGTGCGT GACATTAAGGAG-3¢...

Ngày tải lên: 07/03/2014, 02:20

10 374 0
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

... analysis of the study. MS conceived and coordinated the study and was involved in the interpretation of the data and manuscript revi- sion. All authors read and approved the final manuscript. Acknowledgements All ... interpretation of the data and in drafting the manuscript. PS, JS and MV contributed to the conception and design of the study and manuscript re...

Ngày tải lên: 25/10/2012, 10:39

7 722 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... was determined using the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 using a modified ferrous sulfate ... neutral and alkaline pH; PhyH-DII was less sta- ble under the same conditions (Fig. 2D). PhyH was basically stable at 35 °C, and retained 60% of the initi...

Ngày tải lên: 14/02/2014, 15:20

9 802 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... artifi- cial substrate to assess the kinase activity and GST alone was used as a negative control. The top panel shows the kinase assay visualized by autoradiography and the bottom panel shows the ... kinase buffer and [c- 32 P]-ATP. For (A) and (B) the top panel shows the kinase assay visualized by autoradiography and the bottom panel shows the Coomassie Bril...

Ngày tải lên: 14/02/2014, 19:20

11 701 0
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

... the cell cycle (Fig. 1). Cyclins B1 and B2 appear in S phase and accumulate in G 2 and mitosis before disappearing at the transition from metaphase to anaphase. Synthe- sis is controlled at the ... promoter as analyzed by chromatin immunoprecipitations and can activate tran- scription of the promoter in transient transfection assays through the upstream part of the SIRF...

Ngày tải lên: 16/02/2014, 09:20

17 876 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

... sequences targeted against Itch sequence (siRNA) and analysed for survival using the MTT method (left panel) or lysed and analysed for caspase 3 activity by measuring degradation of the Ac-DEVD-pNA peptide ... reagents and the recombinant human TRAIL ⁄ APO 2 ligand were purchased from Invitrogen and Feldan Bio (St-Laurent, QC, Canada), respectively. The caspase 3 substra...

Ngày tải lên: 16/02/2014, 09:20

12 719 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... Forward (nt 1552–1585 PAI-2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2) SJS261 CTTTGTTA AAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS262 AACTCACCAT AGGAATGCATAAGCTTTAACAAAG ... 1491–1508 PAI-2) SJS138 TACG AGATCT TAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2) SJS172 GGGATCATGCCCA AGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2) SJS173 AGTAAGGAAAATA AG...

Ngày tải lên: 16/02/2014, 09:20

14 636 0
Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc

Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc

... with WB anti-flag WB anti-HA TIAR-flag BOIP-flag HA-hnRNP M RNaseA WB anti-flag WB anti-HA HA TIAR Merged DAPI TIAR-flag BOIP-flag HA-DDX21 RNaseA WB anti-flag WB anti-HA B HA-ASF/SF2 HA-p68 HA-hnRNP ... with haemagglutinin (HA)-tagged candidates in 293T cells and Flag-IP products were analyzed by western blot analysis with anti-Flag and anti-HA sera. The specific- ity of the interacti...

Ngày tải lên: 16/02/2014, 15:20

19 666 0
Tài liệu Báo cáo khoa học: The two Caenorhabditis elegans metallothioneins (CeMT-1 and CeMT-2) discriminate between essential zinc and toxic cadmium docx

Tài liệu Báo cáo khoa học: The two Caenorhabditis elegans metallothioneins (CeMT-1 and CeMT-2) discriminate between essential zinc and toxic cadmium docx

... 5¢-AGC TTGTCGACGTTAATGAGCCGCAGCAGTTCCC-3¢; mtl-2_fwd: 5¢-TATACATATGGTCTGCAAGTGTGACT GC-3¢ and mtl-2_rev: 5¢-AGCTTGTCGACGTTAATGA GCAGCCTGAGCACAT-3¢), generating DNA fragments of 247 and 211 bp for isoform 1 and isoform 2, respec- tively. The purified ... S ⁄ Cl as a scatterer, the difference between O and S is substantial. Therefore, these data suggest that the mechanisms to d...

Ngày tải lên: 16/02/2014, 15:20

12 611 0
w