0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx

Tài liệu Báo cáo khoa học: Regulation of dCTP deaminase from Escherichia coli by nonallosteric dTTP binding to an inactive form of the enzyme ppt

Tài liệu Báo cáo khoa học: Regulation of dCTP deaminase from Escherichia coli by nonallosteric dTTP binding to an inactive form of the enzyme ppt

... of the active site and rearrangement of the main chain and side chains in the active site appearas key players in a slow transformation from aninactive to an active enzyme. dTTP inhibition maythen ... tothat observed for dUTPase. For both the mono- and bifunctional dCTP deaminases, as we show here, and the dUTPase [24], the C-terminal fold is important for the formation of a catalytically ... on data collection and processing(Sawyer L, Isaacs N & Bailey S, eds) pp. 114–122.Daresbury Laboratory, Warrington, UK.35 Navaza J (1994) AMoRe: an automated package for molecular replacement....
  • 11
  • 577
  • 0
Báo cáo khoa học: The transcription factor ZBP-89 suppresses p16 expression through a histone modification mechanism to affect cell senescence doc

Báo cáo khoa học: The transcription factor ZBP-89 suppresses p16 expression through a histone modification mechanism to affect cell senescence doc

... 5¢-AGACAGCCGTTTTACACGCAG-3¢;P2 antisense, 5¢-CACCGAGAAATCGAAATCACC-3¢;P3sense, 5 ¢-TAGGAAGGTTGTATCGCGGAGG-3¢; and P3antisense, 5¢-CAAGGAAGGAGGACTGGGCTC-3¢ [28]. The locations of P1, P2 and ... primer pairs for p16were as follows: sense, 5¢-TTCCTGGACACGCTGGT-3¢; and antisense, 5¢-CAATCGGGGATGTCTGAG-3¢. The b-actin primer pairs were as follows: sense, 5¢-TCGTGCGTGACATTAAGGAG-3¢; and antisense, ... Texas SouthwesternMedical Center, Dallas, TX, USA).RNA extraction and real-time quantitative PCRTotal cellular RNA was extracted from the 293T cellsaccording to the Promega Total RNA Isolation...
  • 10
  • 374
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

... analysis of the study. MS conceived and coordinated the study and wasinvolved in the interpretation of the data and manuscript revi-sion. All authors read and approved the final manuscript.AcknowledgementsAll ... interpretation of the data and in drafting the manuscript. PS, JS and MV contributed to the conception and design of the study and manuscript revision.JK was involved in the design and statistical analysis ... that study, a questionnaire was com-pleted for each radiograph, addressing the indication for the radiograph and whether it changed the patient's management.Of the CXRs performed in the...
  • 7
  • 722
  • 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... wasdetermined using the Bradford assay with BSA as the standard [28].Phytase activity assayPhytase activity was determined by measuring the amountof phosphate released from InsP6using a modified ferroussulfate ... neutral and alkaline pH; PhyH-DII was less sta-ble under the same conditions (Fig. 2D).PhyH was basically stable at 35 °C, and retained60% of the initial activity at 45 °C for 90 min whenassayed ... recombinant PhyH and PhyH-DII required Ca2+ for phytase activity, showed activity at low tem-peratures (0–35 °C) and pH 6.0–8.0, and remained active (at 37 °C) afterincubation at 60 °C and pH...
  • 9
  • 801
  • 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... artifi-cial substrate to assess the kinase activity and GST alone wasused as a negative control. The top panel shows the kinase assayvisualized by autoradiography and the bottom panel shows the ... kinase buffer and [c-32P]-ATP. For (A) and (B) the top panel shows the kinaseassay visualized by autoradiography and the bottom panel shows the Coomassie Brilliant Blue-stained SDS ⁄ PAGE. The ... SJ, Ward ER, RyalsJA & Dangl JL (1994) Arabidopsis mutants simulatingdisease resistance response. Cell 77, 565–577.26 Takahashi A, Agrawal GK, Yamazaki M, Onosato K,Miyao A, Kawasaki T,...
  • 11
  • 700
  • 0
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

... the cell cycle (Fig. 1). Cyclins B1 and B2 appear in S phase and accumulate in G2 and mitosis before disappearingat the transition from metaphase to anaphase. Synthe-sis is controlled at the ... promoter as analyzed bychromatin immunoprecipitations and can activate tran-scription of the promoter in transient transfectionassays through the upstream part of the SIRF element.Mutational analysis ... regulation. The CDE alone was nottested [41]. The CDE mutation that was assayed wouldalso alter a putative CDE site with the standard dis-tance of four nucleotides to the CHR. With the datapresented...
  • 17
  • 876
  • 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

... sequences targeted against Itch sequence (siRNA) and analysed for survival using the MTT method (left panel) orlysed and analysed for caspase 3 activity by measuring degradation of the Ac-DEVD-pNA peptide ... reagents and the recombinant humanTRAIL ⁄ APO 2 ligand were purchased from Invitrogen and Feldan Bio (St-Laurent, QC, Canada), respectively. The caspase 3 substrate (Ac-DEVD-pNA) and the inhibitorsubstrate ... cytochrome c and second mitochondria-derivedactivator of caspase (Smac ⁄ DIABLO) allows for the formation of the apoptosome, a complex that enables the activation of caspases within the cell [18,19].In...
  • 12
  • 718
  • 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... Forward (nt 1552–1585 PAI-2)SJS260 AACTCACCATAGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2)SJS261 CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2)SJS262 AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... 1491–1508 PAI-2)SJS138 TACGAGATCTTAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2)SJS172 GGGATCATGCCCAAGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2)SJS173 AGTAAGGAAAATAAGCTTGGGCATGATCCC Reverse ... 1520–1491 PAI-2)SJS174 GCTCACTGCCTAAGCTTTGTAGCTAATAAAG Forward (nt 1596–1625 PAI-2)SJS175 CTTTATTAGCTACAAAGCTTAGGCAGTGAGC Reverse (nt 1625–1596 PAI-2)SJS259 CTTTGTTATTTATTATGCATTCCTATGGTGAGTT Forward...
  • 14
  • 635
  • 0
Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc

Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc

... withWB anti-flagWB anti-HATIAR-flagBOIP-flagHA-hnRNP MRNaseAWB anti-flagWB anti-HAHA TIAR Merged DAPITIAR-flagBOIP-flagHA-DDX21RNaseAWB anti-flagWB anti-HABHA-ASF/SF2HA-p68HA-hnRNP ... withhaemagglutinin (HA)-tagged candidates in 293T cells and Flag-IP products were analyzed by western blotanalysis with anti-Flag and anti-HA sera. The specific-ity of the interactions was evaluated ... anti-TIARTIAR-TAPTIAR-CBPTIARTA PTA PTIAR-TAP6 6A 767–++RT-PCRWB anti-TIARTIAR-TAPTIARCBFig. 1. Functional characterization of TIAR-TAP protein and purification of TIAR-TAP complexes....
  • 19
  • 666
  • 0
Tài liệu Báo cáo khoa học: The two Caenorhabditis elegans metallothioneins (CeMT-1 and CeMT-2) discriminate between essential zinc and toxic cadmium docx

Tài liệu Báo cáo khoa học: The two Caenorhabditis elegans metallothioneins (CeMT-1 and CeMT-2) discriminate between essential zinc and toxic cadmium docx

... 5¢-AGCTTGTCGACGTTAATGAGCCGCAGCAGTTCCC-3¢;mtl-2_fwd: 5¢-TATACATATGGTCTGCAAGTGTGACTGC-3¢ and mtl-2_rev: 5¢-AGCTTGTCGACGTTAATGAGCAGCCTGAGCACAT-3¢), generating DNA fragmentsof 247 and 211 bp for isoform 1 and isoform 2, respec-tively. The purified ... S ⁄ Cl as a scatterer, the difference between O and S is substantial. Therefore,these data suggest that the mechanisms to deal with zinc and cadmium employed by C. elegans are separate and distinct, ... bothMT-mediated and non-MT-mediated pathways to dealwith cadmium and zinc. We have shown for the firsttime that the responses to cadmium and zinc ions at the cellular level are isoform-specific, and that...
  • 12
  • 611
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam