Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3rev- Gulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3¢. ... 2006 The Authors Journal compilation ª 2006 FEBS 4445 Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gu...
Ngày tải lên: 07/03/2014, 12:20
... the excess heat capacity vs. temperature thermogram of the sample. The baselines before and after transition were selec- ted for the thermogram with the origin 7.0 program, and the transition enthalpy, ... confers thermodynamic and biochemical stability Akshaya K. Meher 1 , Naresh Chandra Bal 1 , Kandala V. R. Chary 2 and Ashish Arora 1 1 Molecular and Structural Biology, Cent...
Ngày tải lên: 30/03/2014, 11:20
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx
... translocation and transcriptional activation of MRTFs, and Rho activity is crucial for actin dynamics. Kuwahara et al. [54] showed that the dominant-negative RhoA mutant inhibits the nuclear accumulation ... MRTFs and SRF activity. Taken together, the small GTPase acts downstream of STARS, and it seems possible that ABLIM integrates signals from the small GTPases, Rac and RhoA (...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo Y học: Mycobacterium tuberculosis FprA, a novel bacterial NADPH-ferredoxin reductase docx
... is that typical of a flavoprotein with bands centered at 381 and 452 nm and shoulders at 422 and 473 nm. Maximal absorbance in the ultraviolet region was at 272 nm. A value of 7.0 for the A 272 /A 452 ratio ... the fractional absorbance change at 452 nm as a function of dithionite/FAD molar ratio. A i and A f are the initial and final values of absorbance at 452...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo khoa học: Mycobacterium tuberculosis ClpC1 Characterization and role of the N-terminal domain in its function ppt
... protein folding and degradation. Proc Natl Acad Sci USA 96, 11033–11040. 16 Weibezahn J, Schlieker C, Bukau B & Mogk A (2003) Characterization of a trap mutant of the AAA+ chap- erone ClpB. ... Journal compilation ª 2008 FEBS Mycobacterium tuberculosis ClpC1 Characterization and role of the N-terminal domain in its function Narayani P. Kar, Deepa Sikriwal*, Parthasarat...
Ngày tải lên: 23/03/2014, 06:20
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf
... covalent modifications of the enzyme, the effect of the inhibitor on the molecular mass value of HAD was measured; instead of an adduct increase, or no change, the value had unexpectedly decreased from 22 ... 4 Da, the decrease of the molecular mass value. The most proba- ble reason for a 2 Da decrease is the formation of an S–S bond; although this was tota...
Ngày tải lên: 18/02/2014, 16:20
Báo cáo khoa học: Tumor necrosis factor-a converting enzyme is processed by proprotein-convertases to its mature form which is degraded upon phorbol ester stimulation pptx
... immature enzyme forms and black arrows the mature forms. (B) Quantitative analysis of mature TACE degradation by Western blot. The ratio of mature TACE to immature TACE was determined in the absence ... involved in a mechanism which decreases the amount of mature TACE (Fig. 5). Discussion The prodomain of the catalytically active members of the ADAM family is thoug...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: "Augmented Dependency Grammer: A Simple Interface between the Grammer Rule and the Knowledge" pptx
... in analysis and synthesis. It also explains the gap in semantics and logical meaning, and gives a clear computaional image of what we call conceptual analysis. This grammar is used for analysis ... FTABLE and THESAURUS Knowledge Base consists of LEXICON, THESAURUS and FTABLE. The case grammar, as a basis of internal representation, which is constructed with the com...
Ngày tải lên: 09/03/2014, 01:20
Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc
... necessary to raise the redox potential to a value that facilitates proper cataly- sis. On the other hand, there are also examples of proteins that normally do not contain a covalent flavin, but have ... activity was measurable, it was clear that the microenvironment around the isoalloxazine moiety of the FAD analog cofactor was dramatically affected [89]. This shows that even...
Ngày tải lên: 16/03/2014, 01:20