Báo cáo khoa học: The human pyridoxal kinase, a plausible target for ginkgotoxin from Ginkgo biloba docx
Báo cáo khoa học: The human pyridoxal kinase, a plausible target for ginkgotoxin from Ginkgo biloba docx
... 2007 FEBS 1045
The human pyridoxal kinase, a plausible target for
ginkgotoxin from Ginkgo biloba
Uta Ka
¨
stner
1
, Christian Hallmen
2
, Michael Wiese
2
, Eckhard Leistner
1
and Christel Drewke
1
1 ... noted that the
K
i
value for ginkgotoxin was determined for the initial
linear range of the plot (Fig. 4A) .
Enzymatic assays with a constant concentratio...
Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx
... 337
TATATAGGTACCTTATGCATCAACAGAGACACTTAC 338
ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC 353
AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG
CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA
AGAATTCAAAGTCTGAAATTCGGGTTTG
TATATAGGTACCTTAACCAGAATCAACTACTTTGTG ... 353
AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG
CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA
AGAATTCAAAGTCTGAAATTCGGGTTTG
TATATAGGTAC...
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... SJ, Ward ER, Ryals
JA & Dangl JL (1994) Arabidopsis mutants simulating
disease resistance response. Cell 77, 565–577.
26 Takahashi A, Agrawal GK, Yamazaki M, Onosato K,
Miyao A, Kawasaki T, ... artifi-
cial substrate to assess the kinase activity and GST alone was
used as a negative control. The top panel shows the kinase assay
visualized by autoradiography and the bottom panel...
Báo cáo khoa học: The identification of a phospholipase B precursor in human neutrophils doc
... attempt was made to purify the 22 ⁄ 42 kDa
doublet based on deacylation activity. However, the
deacylation activity in the acid extracts of granules
was low and the activity disappeared after the ... shifted from the major bands,
coinciding with the appearance of a significant deacyla-
tion activity. Any bacterial contamination of our
protein preparations that might be respon...
Báo cáo khoa học: The propeptide of cruzipain ) a potent selective inhibitor of the trypanosomal enzymes cruzipain and brucipain, and of the human enzyme cathepsin F ppt
... peptide, a prodomain, and a mature
domain that retains catalytic activity. In trypanosomal
CPs, the mature enzyme is composed of a central
domain that corresponds to the mature domain of
mammalian ... select-
ive for the parasite’s enzymes, being practically inca-
pable of inactivating mammalian cathepsins L, K and
B and papain [27]. In another study, the inhibitory
potential...
Báo cáo khoa học: The human cytomegalovirus-encoded chemokine receptor US28 induces caspase-dependent apoptosis pptx
... triggering activa-
tion of initiator caspase 8 and caspase 10, independ-
ent of cellular TNF family death receptor activation,
via a pathway that appears partially dependent on
the integrity of the ... cells and controls (data not
shown). Taken together, these data imply that US28
triggers a death pathway that depends on activation of
initiator caspases 10 and 8, leading rapidly to ex...
Báo cáo khoa học: "The Human Language Project: Building a Universal Corpus of the World’s Languages" pptx
... annotation,
decreases at increasingly fine-grained levels of an-
notation. Where manual fine-grained annotation is
unavailable, automatic methods for creating it (at a
lower quality) are desirable. ... wish to make it possible to investigate human
language equally systematically and on an equally
grand scale: a Human Linguome Project, as it
were, though we have chosen the Human Lan...
![Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx](https://media.store123doc.com/images/document/14/br/gc/medium_Y97X8XlBli.jpg)
Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx
... Wyszynski MW, Gabbara S, Kubareva EA, Romanova
EA, Oretskaya TS, Gromova ES, Shabarova ZA &
Bhagwat AS (1993) The cysteine conserved among
DNA cytosine methylases is required for methyl trans-
fer, ... benzo [a] pyrene-2¢-deoxyguanosine
adducts affects DNA methylation by SssI and HhaI DNA
methyltransferases
Oksana M. Subach
1
, Diana V. Maltseva
1
, Anant Shastry
2
, Alexander Kolbano...
Tài liệu Báo cáo khoa học: The nuclear lamina Both a structural framework and a platform for genome organization pdf
... [13].
Hence, a speculative ancestral lamin gene stands at the
origin of the 65 IF genes that we know for human at
present [14]. The fact that human harbours only three
genes for lamins – lamin A and C are ... the
genome: a marriage made by evolution. Chromosoma
114, 212–219.
32 Glass CA, Glass JR, Taniura H, Hasel KW, Blevitt JM
& Gerace L (1993) The alpha-helical...
Tài liệu Báo cáo khóa học: The unusual methanogenic seryl-tRNA synthetase recognizes tRNASer species from all three kingdoms of life pptx
... University, New Haven, CT, USA
The methanogenic archaea Methanococcus jannaschii and
M. maripaludis contain an atypical seryl-tRNA synthetase
(SerRS), which recognizes eukaryotic and bacterial
tRNAs
Ser
, ... heterologous tRNAs
Ser
and
tRNAs
Sec
by SerRSs from methanogenic archaea. (A) Serylation was
performed at 37 °C and the charging plateau with M. maripaludis
(filled bars) and M. jan...