Báo cáo khoa học: Discovery of a eugenol oxidase from Rhodococcus sp strain RHA1 ppt
Báo cáo khoa học: Discovery of a eugenol oxidase from Rhodococcus sp. strain RHA1 ppt
... article, we describe the production, purification and characterization of this novel oxidase from Rhodococcus sp. strain RHA1. The bacterial oxidase was found to be most active with eugenol, and ... van der Zwan RP & de Bont JAM (1992) Purification and characterization of vanillyl-alcohol oxidase from Penicillium simplicissimum: a novel aromatic oxidase containing c...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt
... amino acid sequence of hemerythrin from Siphonosoma cumanense. Protein Seq Data Anal 3, 141–147. 43 Yano H, Satake K, Ueno Y & Tsugita A (1991) The amino acid sequence of the beta chain of ... importantly, two local maxima of 330 and 380 nm were also revealed. These maxima are typical of diiron-centre absorbance, and thus characteristic for all haemerythrins [12]. This str...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx
... of C-terminal aspartate also observed. Glutamate carboxyp- eptidase activity was present in larval gut extract from H. armigera. The HaCA42 protein is the first glutamate- specific metallocarboxypeptidase ... and analysed by SDS/PAGE. Carboxypeptidase assays and expression of HaCA42 mRNA Carboxypeptidase assays using the synthetic substrates furylacryloyl-Phe-Phe (FAPP), furylacryloyl-Ala...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: Selection of a CXCR4 antagonist from a human heavy chain CDR3-derived phage library doc
... an antagonist (IC 50 =23lm) and displayed an affinity of 5.6 lm. A discrepancy in the potency of clone 3 in phage format (nanomolar range activity) and in peptide format (micromolar range activity) ... H, Oyake H, Murakami T, Arakaki R, Nakashima H, Otaka A et al. (1998) Pharmacophore identification of a chemokine receptor (CXCR4) antag- onist, T22 ([Tyr(5,12),Lys7]-polyphemusin II)...
Ngày tải lên: 28/03/2014, 22:20
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... substantia nigra is a neuropathological hallmark of Parkinson’s disease. This leads to a decreased level of dopamine in the striatum. As a result, synaptic transmission is nega- tively affected ... of rasagiline, a MAO-B inhib- itor, on the aggregation of a- synuclein, is because of its action as a free radical scavenger [36]. Thus, it may be speculated that dopamine exhi...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAATTAC cyc1-w GAACCAATGAAATAAGGGCG cyc1-x...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masar...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... University of Aarhus, Denmark 4 Department of Medical Biochemistry, University of Aarhus, Denmark 5 Department of Clinical Biochemistry, AS Aarhus University Hospital, Denmark Cobalamin (Cbl, vitamin ... adenosylcobalamin in patients diagnosed with various malignancies. Mayo Clin Proc 75, 568–580. 4 Bagnato JD, Eilers AL, Horton RA & Grissom CB (2004) Synthesis and characterizatio...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt
... 5¢-GACACCGTAGGTTGAGCCGCCAATC GTCCC-3¢; NP5, 5¢-CTTTAACTTGTTGGGCACTGG CATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCC CA-3¢ along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC-3¢) and AP2 ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) and downstream...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf
... EF & Maniatis T (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbour, NY. A. Parthasarthy and K. P. Gopinathan Regulation of pol ... shut off. By contrast, when there is demand for large excesses of a particular type of tRNA, as in the PSG, and sufficient quantities of transcription factors are available, transcriptio...
Ngày tải lên: 20/02/2014, 02:21