Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

... The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex Rachel V. Dunn 1 , Ker R. Marshall 2 , Andrew ... Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA A CCATGGAGAATCAAGAGAAGGCGAGTATCGCGG G-3¢ and 5¢-GAGAG CTCGAGAACAGAACTTCAAGAC CGTGGCAGGAGC-3¢....

Ngày tải lên: 07/03/2014, 06:20

... or associa- tion measures yield scores indicating to what de- gree a candidate qualifies as a term or a colloca- tion. While term mining and collocation mining, as a whole, involve almost the same ... Proceedings of the 39th Annual Meeting of the Association for Com- putational Linguistics and the 10th Conference of the European Chapter of the Association for Com- p...

Ngày tải lên: 31/03/2014, 01:20

... 5¢-CGTCCG CGT GCAAACGTGG and 5¢-CCACGTTTGCACGCGG ACG for P20 2A (pHO380), 5¢-CGCCGTCCGCGTCCA GCTGTGGCGGAAGTCATGAATATTGTAGGTAACATC GAAGGG and 5¢-CCCTTCGATGTTACCTACAATATTC ATGACTTCCGCCAC AGCTGGACGCGGACGGCG ... for N20 3A (pHO392), 5¢-CGCCGTCCGCGTCCAAAC GCCG CGGAAGTCATGAATATTGTAGGTAACATCGAAGGG and 5¢-CCCTTCGATGTTACCTACAATATTCATGACT TCCGC GGCGTTTGGACGCGGACGGCG for V20 4A (pHO393), 5¢-CGTGGCG G...

Ngày tải lên: 23/03/2014, 15:20

... France Human UMP-CMP kinase (UCK) plays a key role in the ribonucleoside and deoxyribonucleoside salvage pathway and in the anabolic phosphorylation of nucleo- side analogs used as antiviral and anticancer ... NMP kinase [2] and finally NDP kinase [3] and ⁄ or one of the enzymes capable of synthesizing ATP, such as phosphoglycerate kinase [4,5], pyruvate kinase or creatine ki...

Ngày tải lên: 07/03/2014, 09:20

... caspases and that the most promising caspase inhibitors tested in clinical trials are pan-caspase inhibitors, the ability to inhibit most of the caspases is a desirable feature of isoquinoline-1,3,4-trione ... against Ab(25– 35)-induced apoptosis by attenuating the activation of caspases and associated caspase cascades. Further study is in progress to verify their therapeu...

Ngày tải lên: 07/03/2014, 11:20

... ph i hợp thử nghiệm nhiều lần và đã tìm ra được quy trình khắc ph c như sau: - Dùng giấy nhám thô v a ph i đánh sạch bề mặt bị châm kim; - Pha loãng sơn lớp 2, phun lớp mỏng lên bề mặt v a ... s a ch a các mặt bích hở 80mm ÷ 90mm là thay đoạn ống bị hụt bằng đoạn ống dài hơn (khi nối ống có lót ống bên trong). Giàn giáo ph c vụ s a ch a lắp dựng ở r a sàn thao tác. Theo đề xuất...

Ngày tải lên: 23/03/2014, 06:20

... environment and may play a role in the resistance against killing by alveolar macro- phages [23,27,28]. In contrast to that the white conidia of a pksP mutant strain posses a plain surface and seem ... generally contain large amounts of proteins we can assume that a germinated A. fumigatus spore will use these proteins as carbon source. In that case, the amino acids i...

Ngày tải lên: 23/03/2014, 15:20

... by: F D ¼ A T À A N =A D À A N Where A N is the absorbance of the protein sample at 30 °C, A D is the absorbance of the sample at 80 °C and A T is the absorbance of the protein sample at different ... cuvettes and equilibrated at 30 °C to obtain the baseline. The samples were heated from 30 °Cto90°C at the rate of 1 °CÆmin )1 using a programmable ther...

Ngày tải lên: 18/02/2014, 16:20

... eukaryotic translation and mRNA stability. A short upstream open reading frame strongly inhibits translational initiation and greatly accelerates mRNA degradation in the yeast Saccharomyces cerevisiae. J ... pre-rRNA processing in Saccharomyces cerevisiae Daniela C. Granato 1 , Fernando A. Gonzales 1 , Juliana S. Luz 1 , Fla ´ via Cassiola 2 , Glaucia M. Machado-Santelli 2 and Carla...

Ngày tải lên: 20/02/2014, 01:20

... Domain complexity appears to be a factor in how much training data is needed: using Dice as an evaluation metric, training sets of 10 sufficed in the simple furniture domain, while in the more complex people ... REG challenges. For the sake of compari- son, we also follow the evaluation methodology of the REG challenges, training and testing on two do- mains (a furni...

Ngày tải lên: 07/03/2014, 22:20