Báo cáo khoa học: Gene expression silencing with ‘specific’ small interfering RNA goes beyond specificity – a study of key parameters to take into account in the onset of small interfering RNA off-target effects potx
... such as small interfering RNAs (siRNAs) or microRNAs, leading to the degradation of a particular mRNA (slicing) or to repression of translation [2,3]. Thereafter, the use of chemically synthesized ... cell transfection with siRNAs, total RNA was extracted using the Total RNAgent extraction kit (Pro- mega, Madison, WI, USA). mRNA contained in 5 lgof total RNA was...
Ngày tải lên: 07/03/2014, 05:20
... 5¢-ATCGACGGGCCTGACTCAT-3¢, 5¢-CAACATTGAGCCCAGCAATAAC-3¢,5¢-CAGCTAT TTAAGCCGTCTTTTCCA-3¢,5¢-GATAGATGCAGAGC CACCAAAGA-3¢,5¢-CGGACATGAGAGAGCAAAGT CA-3¢,5¢-CAGCTGCAAATTATGGTGAAG-3¢ and 5¢- ACCCGACGGTGGTGACTACA-3¢, were ... RT-PCR with a forward primer, 5¢-ACGTCGCTGCAGCGATCT GATCACTGAGAAAC-3¢, and a reverse primer, 5¢-AAA GCCGGTACCCTCTGCTATTACAATGACGAAAACGAT TATC-3¢, using mRNA from Arabidop...
Ngày tải lên: 07/03/2014, 21:20
... idea of the amount of vari- ation at the single gene level explained by the above described mode, we calculated a scale independent index of the range of variation of each of the 7160 ORFs in the ... by their mutual correlation with pc1rand, thus indicating an aspecific (from the point of view of the biological role of the involved genes) character...
Ngày tải lên: 30/03/2014, 08:20
Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx
... general RNA binding domain appended to plant methionyl-tRNA synthetase acts as a cis-acting cofactor for aminoacylation. EMBO J 19, 690 8–6 917. 38 Kaminska M, Shalak V & Mirande M (2001) The appended ... possess a tRNA-binding motif, but it instead participates in the formation of a specific ternary complex with seryl-tRNA synthetase and tRNA Ser , strengthening the...
Ngày tải lên: 23/03/2014, 09:20
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... reintroducing the nrdF gene into the genetic background of corynebacteria comprised an initial transfer into the accessible species C. glutamicum and the performance of a second, final gene transfer into C. ... cannot, however, explain the remarkably broad wings of the signal. The broad lineshape and the enhanced relaxa- tion properties of the signal at 77...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Gene silencing at the nuclear periphery pdf
... components of the nuclear lamina shown to interact with transcriptional regula- tors include LAP 2a, a nucleoplasmic LAP2 isoform, and lamin A ⁄ C [5 4–5 6]. LAP 2a was shown to complex with lamin A ⁄ C and ... cardiomyopathy [71]. Two NPC pro- teins, ALADIN (also termed Adracalin or AAAS) and nup62, can be added to the expanding list of mutated nucler lamina protei...
Ngày tải lên: 19/02/2014, 02:20
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt
... 5¢-GGTTATCATA TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢.ThethirdPCRwas carried ... molecules in the treatment of several pathologies and because of the potential use of the toxins as biological weapons. Alteration of their MH...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: SOX10, in combination with Sp1, regulates the endothelin receptor type B gene in human melanocyte lineage cells pptx
... mapping analysis of EDNRB transcripts. An autoradiogram of the S1 nuclease mapping analysis is shown. Total RNA was prepared from the indicated cell lines at the top of panel. The S1 probe and ... 5¢-CCCAAGCTTATGGCGGAGGAGCAGGAT CTATCGGAGGTG-3¢ (sense) and 5¢-GCTCTAGATGA GGTGGGCAAGGAACAGGGCACACAGGCT-3¢ (anti- sense); and GAPDH: 5¢-ACCACAGTCCATGCCATCAC 3¢ (sense) and 5¢-TCCACCAC...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: Structure, expression and regulation of the cannabinoid receptor gene (CB1 ) in Huntington’s disease transgenic mice ppt
... an arrow and asterix. The relative mobility of biotin-labelled RNA ladder (L) is indicated to the left of each blot. A 1 lgaliquotofeachRNAsample shownin(C)and(D)wassubjectedtoRPAusingtheb-actin-specific ... stability of CB1 mRNA was affected in a manner that was dependent on the length of the CAG repeat and relative expression of the human HD transgene in th...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Gene cloning, expression and characterization of avian cathelicidin orthologs, Cc-CATHs, fromCoturnix coturnix pdf
... C G ATGA acg-t c 480 Cc-CATH1 actgtcccctcgctgccttccatccaataaa ggtctttgctggtaaaaaaaaaaaaaaaa 531 Cc-CATH2 TTG-CTGAg-gaataaa -ggggc gtgtg c-accaagc -a 517 Cc-CATH3 g tc a cc c aataaa -c-g ttca-gct ... SignalP ⁄ ) indicates a 17 amino acid signal peptide located at the N-termi- nus. Noticeably, four cysteines that are conserved in the cathelin domain of all cathelicidins identified...
Ngày tải lên: 28/03/2014, 23:20