Báo cáo khoa học: The F13 residue is critical for interaction among the coat protein subunits of papaya mosaic virus doc

Báo cáo khoa học: The F13 residue is critical for interaction among the coat protein subunits of papaya mosaic virus doc

Báo cáo khoa học: The F13 residue is critical for interaction among the coat protein subunits of papaya mosaic virus doc

... generate the monomeric form of the CP. Furthermore, we have shown that residue F13 is critical for self-assembly of the CP subunits into NLPs. The replacement of F13 with hydrophobic residues ... led to formation of either NLPs (F13Y and F13L) or monomeric forms of the protein (F13G, F13A, F13R, F13E, F13S), which were always detrimental to accumulation of...

Ngày tải lên: 07/03/2014, 05:20

11 333 0
Báo cáo khoa học: Signal peptide hydrophobicity is critical for early stages in protein export by Bacillus subtilis ppt

Báo cáo khoa học: Signal peptide hydrophobicity is critical for early stages in protein export by Bacillus subtilis ppt

... primer for construction of truncated AmyQ variants for synthesis of nascent chains amyQ95 GCCGGATCCTTCTCCTAAATCATACAA Amplification primer for construction of truncated AmyQ variants for synthesis of ... around the filter, which can be visualized by staining of the plates with iodine vapor. The radius of the resulting halos is indicative for the amounts of ac...

Ngày tải lên: 16/03/2014, 22:20

14 282 0
Báo cáo khoa học: Sp3 transcription factor is crucial for transcriptional activation of the human NOX4 gene doc

Báo cáo khoa học: Sp3 transcription factor is crucial for transcriptional activation of the human NOX4 gene doc

... January 2011) doi:10.1111/j.1742-4658.2011.08018.x NOX is the catalytic subunit of NADPH oxidase, the superoxide-generat- ing enzyme. Among several isoforms of NOX, NOX4 is abundantly expressed in various tissues. To clarify the mechanisms of ... dramatically decreased by the deletion of GC-box1. The activity was further decreased by the deletion of GC-box2 (Fig. 3...

Ngày tải lên: 29/03/2014, 00:20

9 362 0
Báo cáo khoa học: "A Stacked Sub-Word Model for Joint Chinese Word Segmentation and Part-of-Speech Tagging" potx

Báo cáo khoa học: "A Stacked Sub-Word Model for Joint Chinese Word Segmentation and Part-of-Speech Tagging" potx

... was then further used in POS tagging in (Ng and Low, 2004). One main disadvantage of this model is the difficulty in incorporating the whole word information. The second kind of solution is the ... Seg C and SegTag L are the predictions of the three coarse- grained solvers. For the three words at the begin- ning and the two words at the end, the three predic-...

Ngày tải lên: 17/03/2014, 00:20

10 412 0
Báo cáo Y học: DAP kinase activity is critical for C2-ceramide-induced apoptosis in PC12 cells ppt

Báo cáo Y học: DAP kinase activity is critical for C2-ceramide-induced apoptosis in PC12 cells ppt

... triggers the formation of reac- tive oxygen species, the disruption of electron transport and energy metabolism, and the release of caspase-activating proteins, c ytochrome c, a nd apoptosis-inducing ... residue within the kinase domain is replaced by an alanine residue, is inactive. The death- promoting function of DAP kinase requires t he kinase activity; therefore...

Ngày tải lên: 24/03/2014, 00:21

9 484 0
Báo cáo khoa học: Hydrogen bond residue positioning in the 599–611 loop of thimet oligopeptidase is required for substrate selection pdf

Báo cáo khoa học: Hydrogen bond residue positioning in the 599–611 loop of thimet oligopeptidase is required for substrate selection pdf

... requires neither Tyr residue for efficient turnover by TOP. This distinction among substrates has allowed for a careful analysis of the role of the conserved Gly residues in the 599–611 loop. The flexibility ... the flexible loop region of TOP is responsible for this enzyme’s posi- tioning of substrates for catalysis [15]. The present results clarify the prima...

Ngày tải lên: 23/03/2014, 06:20

11 395 0
Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx

Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx

... signal is impaired. We finally examined the effect of deletion of the components of the PDZ binding motif on the signal- ing properties of the receptor in Ca 2+ imaging experiments. Truncation of the ... and have elucidated the molecular details of this interaction. The primary source of olfactory signaling and the sites of expression of ORs are the cil...

Ngày tải lên: 18/02/2014, 13:20

12 543 0
Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx

Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx

... during the f orced molecular dynamics calculated with the torque of 56 pNÆnm. The secondary structure of c is shown for the time of 1 ns (the end of initial equilibration), 17 ns (half of turnover), ... main axis of the shaft. The ‘bearing’ included a total of 138 residues from the neighbouring portion of (ab) 3 located within 1.8 nm from the rotary axis (...

Ngày tải lên: 19/02/2014, 16:20

9 547 0
Báo cáo khoa học: Arabidopsis thaliana CYP77A4 is the first cytochrome P450 able to catalyze the epoxidation of free fatty acids in plants potx

Báo cáo khoa học: Arabidopsis thaliana CYP77A4 is the first cytochrome P450 able to catalyze the epoxidation of free fatty acids in plants potx

... given in Fig. S2. The regioselectivity of CYP77A4 was determined on the basis of the peak area of each metabolite detected by GC. Metabolites of oleic acid For the analysis of the products generated ... S4. The regioselectivity of CYP77A4 was determined on the basis of the peak area of each metabolite detected by GC. Metabolites of linoleic acid For the...

Ngày tải lên: 07/03/2014, 03:20

17 544 0
Báo cáo khoa học: Neuroserpin Portland (Ser52Arg) is trapped as an inactive intermediate that rapidly forms polymers Implications for the epilepsy seen in the dementia FENIB ppt

Báo cáo khoa học: Neuroserpin Portland (Ser52Arg) is trapped as an inactive intermediate that rapidly forms polymers Implications for the epilepsy seen in the dementia FENIB ppt

... b-sheet A to form a latent conformer [16]. However, this is unlikely as the latent conformer of the serpins is unable to form polymers [17,18]. Other charac- teristics of the latent conformer are ... of Ser52Arg neuroserpin is similar to that of the polymeric conformation in which b-sheet A is filled with the reactive loop of another neuroserpin molecule. Moreover t...

Ngày tải lên: 07/03/2014, 16:20

8 495 0
Từ khóa:
w