Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx
... 5875 Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF 2a- kinases Eric Cardin, Mathieu Latreille, Chamel Khoury, Michael T. Greenwood and Louise Larose Polypeptide Laboratory, ... homology domains and classically implicated in cell signaling by activated plasma membrane receptor tyrosine kinases, modulates eIF 2a- kinase-mediated eIF2aSer51 ph...
Ngày tải lên: 07/03/2014, 05:20
... heuristic 333 estimate of the remaining cost for completing the translation. The variant which is mostly used is a form of beam-search, where several partial can- didates are maintained in parallel, and candidates for ... France mikhail.zaslavskiy@ensmp.fr {marc.dymetman,nicola.cancedda}@xrce.xerox.com Abstract An efficient decoding algorithm is a cru- cial element of any statistical...
Ngày tải lên: 20/02/2014, 07:20
... evaluation measure separately (by only using the rewards given for that particular measure), and a policy based on a combination (sum) of the rewards for all evalu- ation measures. We found that the learned ... state/action management The dialogue state is unique at every stage of the conversation and is represented as a vector of feature-values. We use only a limited set of...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo khoa học: "Dictionary Definitions based Homograph Identification using a Generative Hierarchical Model" docx
... sets of dic- tionary definitions. After training, each of the 225 words was annotated by each annotator. On aver- age, annotators categorized each word in just 19 seconds. The inter-annotator agreement ... Four annotators at, the Qualitative Data Analysis Program at the University of Pittsburgh, were 1 http://research.microsoft.com/~minka/software/fastfit/ trained to identify...
Ngày tải lên: 31/03/2014, 00:20
Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"
... physician paternalism into the surrogate decision-making equation is ethically unacceptable. Most rational surrogates are unwilling to continue life support after a reasonable trial has demonstrated ... that there is no meaningful chance of reanimation [8]. Some reasons why this occurs are as follows: 1. Physicians tell surrogates that they can make any decision they want as an open-ended...
Ngày tải lên: 25/10/2012, 10:45
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... CCTTTGACATCGCAAGTGGATCA RPE65c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCA...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx
... Hussain 1,2, *, Liang Yu 1,3, *, Rani Faryal 1,2 , Dara K. Mohammad 1 , Abdalla J. Mohamed 1,4 and C. I. Edvard Smith 1 1 Clinical Research Center, Department of Laboratory Medicine, Karolinska Institutet, ... agammaglobulin- emia. A clinical and molecular analysis. Medicine (Baltimore) 75, 287–299. 27 Plebani A, Soresina A, Rondelli R, Amato GM, Azzari C, Cardinale F, Cazzola G, Consol...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: Membrane targeting and pore formation by the type III secretion system translocon pdf
... 213–222. 66 Hamaguchi M, Hamada D, Suzuki KN, Sakata I & Yanagihara I (2008) Molecular basis of actin reorgani- zation promoted by binding of enterohaemorrhagic Escherichia coli EspB to alpha-catenin. ... Y, Sagara H, Kabe Y, Azuma M, Kume K, Ogawa M, Nagai T, Gillespie PG, Sasakawa C & Handa H (2007) The enteropathogenic E. coli effector EspB facilitates microvillus effacing an...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx
... an exciting area of research and poten- tially a therapeutic avenue to treat obese and diabetic people. Manipulating metabolic pathways for the treat- ment of disease has once again placed basic ... [41–45]. There are at least six carnitine acyltransferases in mammals [46]. Carnitine acetyltransferase and carni- tine octonyltransferase mediate the transfer of acetyl and short- to medi...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: 3T3-L1 adipocyte apoptosis induced by thiazolidinediones is peroxisome proliferator-activated receptor-c-dependent and mediated by the caspase-3-dependent apoptotic pathway doc
... 693 TTTTTCAGTGCAGAA-3¢; aP2 forward, 5¢-AAAGACA GCTCCTCCTCGAAGGTT-3¢; and aP2 reverse, 5¢-TGA CCAAATCCCCATTTACGC-3¢. Standard curves were gen- erated with 10-fold serial dilutions ranging from ... the same sample. The PCR primers were as follows: actin forward, 5¢-GA AATCGTGCGTGACATCAAAG-3¢; actin reverse, 5¢-TG TAGTTTCATGGA TGCCACAG-3¢; Akt-1 forward, 5¢ -A ACGGACTTCGGGCTGTG-3¢; Akt-1 ... r...
Ngày tải lên: 16/02/2014, 09:20